Basic Information

Symbol
PRKCG
RNA class
mRNA
Alias
Protein Kinase C Gamma PKC-Gamma PKCC PKCG Protein Kinase C Gamma Type EC 2.7.11.13 MGC57564 SCA14 Protein Kinase C, Gamma EC 2.7.11 PKCgamma PKCI(3) PKCγ
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_002739.5
Sequence length
3149.0 nt
GC content
0.6132

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1252.00 kcal/mol
Thermodynamic ensemble
Free energy: -1306.17 kcal/mol
Frequency: 0.0000
Diversity: 573.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((((((((((((((((((((....(((.((....))..))).)))))))).))))))))...(((...)))((..(.((((.....(((((((......))))).)).(((((((((((((.......)))))...))))))))..(((...(((((.((...)).)))))..)))((((...(((...)))..))))....(((((....)))))((((((((..((..................(((((.((((((((((.........))))))...)))))))))...(((((((..((((....(((..(((.((...(((((((((.....(((((((.(((....))).))))))).....(((((((((((.....((((....((((............))))....)))).......))))))))))).(((.((((.((((((((....))))..))))...)))))))............(((.((((.((((((((((......)).)))))))).)))))))....(((((..(((((((((((..(((((.((((((((.........(((((........)))))(((((((((((.((((((((...((...(((.((.......(((.((((((..((((..(...((((.((((((((...)))).)))).))))....)..)))).((((((((..((((....((.((((((((.(((.(((((((...))))))).)))((((((((((((((((((.(((((.((((((.(..((((((.((.(.....).)).))))))..).))))))..............(((((..(((.((((((..................(((..........)))(((.((((...(((......))).....))))..))).....((((((........))))))...)))))).))).))))).......((((((((((((((..(.(((..((.(((.((((((.(((........))).)))))))))...)).....))).).)))))))))))))))))))..))))))...))))))))))))....(((((.((......)).)))))..)))))))).))..))))..))))))))((((((.((((.....(((((((((............))))).))))........((((((......(((.(((.(.(((((((.............))))))).).))))))..(((((((.((((((((((.((.((((.......((((((((((((((((((((((.....(((....(((.........))).....)))....))))...(((((.(((((.((((((((((((((((((((((((((.((.....)))))).)))..........(((((....)))))........((((.((((.....(.((((((((......(((.(((.((((((((((.((((.(((((.(((.(((.......(((....(((((((.(((.....((((((....((((((((.(((((((.....)))))))(((.((((((((((((((((((...))).))))..((.((((...........))))...)).((((...))))(((.((........)).)))(((((((((((((..(((..((((((((...(((..........)))......)))))))).)))..))))))((((((((((.((...)).))))..)))))))))))))..)))))))))))))).....((((((.....))))))....((((((.(((((..(.((((........)).)).)..)))))...))))))......))))))))))))))(((((((((..........)))))))))..(((((((.....)))))))..)))..)))))))....)))(((...)))........((((...(((((..((......(((((....))).))......))..)))))...))))...(((....(((.((.(((((((((..(((.(((.((((........(((((((((((..(((((..((.(((((...((((((..(((((((((..((..((((.......))))..)).....(((((((((((((((...))))((((((((....))))))))))))))))))).((....)).......))))).))))))))))....)))))...))..)))))((..((..(((.(((((....)))))))).))..))))))))..)))))))))))).)))...))))))).))))...)))....)))..........)))))).)))))...))))...)))))).((((((...)))))))))).)))...)))......))))))))).....))))))))(((((.(((((.....(((......)))........))))).)))))..)))))).....))))))..))))...............))).))....))).))))).((((((...))))))((((.........)))).........))))))))))))).)))))....((((.(((((((((.............(((((......)))))...............))))..))))).))))..((((((.........))))))...))))))...)))))))).)).....)))).)))))))))..))))..))))))...(((((.....)))))(((((...........)))))))))).).))).......)))))...))...))))))))))).((((((..(((((((((..(((.(((.....))))))((((((.......)))))))))))))))..))))))....((((......)))).....((((.....)))).))))).)))..))))))))...)).)))............))))))))))).)))))...((((......)))).))))))))))))))..)))...)))).))))))).))..))))))))........)))).)..)))))))))
Thermodynamic Ensemble Prediction
....,((((((((((((((((((((((....(((.((....))..))).)))))))).))))))))...(((...))).....,.((((.{.((((.(((((.....}.))))).))}),}...)))).}..((((((.((..(((((.(((({....,)))))))))..)).........{{((((...((,...,}),.))))}...{((((....))))}((((((((..{{............,,....{(((,,((({((((((,,....|||||)))}...})))))))),..(((((((..((((....(((..(((.((...(((((((((,....(((((((.{((....})}.)))))))..,.,(((((((((((.,...((((....((((............))))....))))..,..}.))))))))))).(((.((((.((((((((....)))),.})))...))))))),|||,.......(((.((({.((((((((,(,,,...)),)))))))).})))))}....(((((..(((((((((((.,(((((.((((((((.........(((((........)))))(((((((((((.((((((((...{{...(((.((.....{,(({.(((,,,..,{{|,,(,,.((((.((((((((...)))).)))).)))).,,.}..||}|(((((((((..((((.{{.{(.((((((((,{((.(((((((...))))))).))}((((((((((((((((((.(((((.((((((,{{.((((((.((.{.....).)}.))))))}.),)))))).........,,...(((((..(((.((((((,,,,........{,{,...,,....}}},..,}}{{{.((((...(((......))).....)))}..))).....((((((........))))))...)))))).))).)))))....}},((((((((((((((..(.((({.((.(((.((((((.(((........))).)))))))))...)).....})).).)))))))))))))))))))..))))))...))))))))))))....(((((.((......)).)))))..)))))))).))}}))))..))))))))|{{{((.((((.....,|||||{{{...,...,}...|||||,,}}|,,,,,,..{((((,,,....(((.(((.(.(((((((.............))))))).).)))})),.,,,{(((.{,,{((((({,((,,{{|}||....((((((((((((((((((,,(({({(((((,{,..{.{{(((({...,,....})))...})}}}...,,|}|,}|}},}}},(((((((((((((((((((((((.((.....))))))},}},{{{.....,|{(((...,||||,..|}}}}.|||(,((((.....{.((((((((....(,({(.(((.((((((((((.((((.(((((,(({,(({.......{({....(((((((.(((.....((((((....((((((((.(((((((,...,)))))))(((.((((((((((({((((((...)))}}))}..(({((((...........))))}}.)).((((...))))(((.((........)).)))(((((((((((((..(((..((((((({...(({...,|.....,,),.....)))))))).)))..))))))((((((((((.{{...}}.)))),.})))))}))))))..)))))))))))))).....((((((.....))))))....((((((.(((((..{.((((........)).)).}..)))))...))))))......))))))))))))))(((((((({..........})))))))).,(((((((.....))))))).,)))..)))))))..,.}}},{,...|||.,,.....||,,...,{(({..({.({{{.,,((({{{.||,,,|{.....)).,,)),)}}})),,.,}}}||...||}..{,{||||(((.,.(((,{((.(((((.......(((((((((((..(((((..((.(((((...(((((({.{((((((((..((..((((.......))))..)).....(((((((((((((((...))))((((((((....))))))))))))))))))),{,....}}.......))))).))))))))))....)))))...))..)))))({..{{..(((.(((((....))))),))})}..}))))))}.,)))))...,...))))}.}))))),).))}}}}}),,,...,}........,..)))))).}})))...))))...)))))).((((((...)))))))))).)))...)))......))))))))......))))}},{(((((.(((((.....(((......))}..}.....))))).)))))}.)))))).....))))))..))))..,{(,{{.,...,{.||.......)),}),,.}.||||||},.,}}||}|(({.........))))}}.......))))))))))))).)))))....|((({..{,|}}|,,,..,,,......(((({......}))))...{{||.,,,,},,}))))))}.}},)}))).{{{(((.........))))))...,|||||,..||||||||{||{{{..|||,.,,)))),,)}}))))}.}})))).,.|||||....,|||||(((((...........))))))))))}).}}}.......}}}}),,,))...))))))))))).((((((..(((((((((..(((.(((.....))))))((((((.......)))))))))))))))..))))))....((((......)))).....((((.....)))).))))).))),,))))))))...)).)))..........}.))))))))))).)))))...{(({...,,,)}})})))}))))))))))..)))...)))).))))))).})..))))))))........)))).)).,.)))))),

Transcripts

ID Sequence Length GC content
ACAUUUCAGCAGGUGCCGGAGCUGGAGCUCCCACCGCCGCCGCCCGUGC… 3047 nt 0.6114
ACAUUUCAGCAGGUGCCGGAGCUGGAGCUCCCACCGCCGCCGCCCGUGC… 3149 nt 0.6132
Summary

Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]

Forensic Context

A study in post-mortem human brain tissue demonstrated that the PRKCG is down-regulated in chronic traumatic encephalopathy (CTE), CTE with Alzheimer's disease (CTE/AD), and Alzheimer's disease (AD) compared to normal subjects, identifying it as a memory function-related gene whose dysregulation is linked to head injury-related pathology [Cho et al. DOI:10.1038/s41598-020-65916-y]. A separate study in mice subjected to controlled cortical impact found that the PRKCG was down-regulated in the neocortex, corpus callosum-external capsule, and striatum at two days post-injury [Kounelis-Wuillaume et al. DOI:10.1177/08977151251390528].