Basic Information

Symbol
PRKCH
RNA class
mRNA
Alias
Protein Kinase C Eta PKC-L PKCL PRKCL Protein Kinase C Eta Type Protein UPEP2 EC 2.7.11.13 NPKC-Eta UORF2 PRKCH Upstream Open Reading Frame 2 Protein Kinase C, Eta EC 2.7.11
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_006255.5
Sequence length
3720.0 nt
GC content
0.5067

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1286.60 kcal/mol
Thermodynamic ensemble
Free energy: -1352.32 kcal/mol
Frequency: 0.0000
Diversity: 1136.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((((.((...)).))))))((((((......)))))).(((....((((((((((.((((((((.(((.(((((((..((.((.(((((((((.((((((.(((((((.........((((.(((((((((((.....(((((((((.(.((...((((((......)))))).(((((((((...((......))..)))))))))((((.....)))))).).)).))))))).((((((((((.(((.((..((.(.((...(((((((((((((((((.........))))))))(((((((((((((.(((....)))..)))))))))))))((((....)))).))).))))))...)).)))..)).))).))))...))))))..))))))))...))).))))..))))))).))))))))))))))).))))((((((((...))))..)))).((((((...))))))((((((....))))))(.((((((((((((((.....).))))).((((........))))..(((((((((.((((.(((((((.(.((((((((((..((((((.(((((((((..(((((((.((.((....(((((((...((((...))))..)))).)))))))))).))))))))))...))).)))))).....)))).))...............((((((.(((...))).)).))))..))))..).)))))))..)))).).)))))))).(((.(((((....))))))))((((((((((((.....))))))))(((((((...))))))).)))).)))))))).).(..(((((.(((((((....))))))))))))..)........((((.(((........))).)))).....)))))))))))))))))).(((((((..((((....))))..))..)))))........)))))))))))))...(((((.(((....)))))))).(((......)))...)))))))))(((((((.(((((.(((((........))))).((((((((..((((.......((.(((((((((((.(((((((...((.(....).)).)).)))))....))).)))))))).)).................((((((((((.((....(((((((......((((((((((((.(((..((((....))))(((((....)))))((((((((((.((((......(((...(((((((.((............))))))..)))....)))......)))).....))))))..))))...(((((((.........)))))))(((((((((((....(((.(((((.......)))))..)))(((((((((((((((......)))))))...((((.....))))(((........)))((((((((..(((((((((...((..((((........))))....)).............))))))))).)))))))).....)))).)))).))))))))))))))))))))))))))...))))))))).)))...(((..((((..((((((((..((((((..........((((((...((((.((((.....((((((..(((((..((((((((((((.((...(((((((((((((........((((..((....)).))))(.((((.((.((((...((((((((.((((......))))....(((((........)))))......)))).))))...)))).)).)))).)..)).))))))))))).(((((((((((.(((((...))))))))))...)))))))).)))))).))))))((((((((((...((((((((((((......))))).....(((...(((((((((.....((((....))))....(((((((......(((((((...(((((...(((((.((.((((........((((((..((((((.......)))))).))))))........(((.(((..(.(((.((((....(((((((......)))))))..)))).))))..)))))).((..(((...)))..))(((.((((((...((((....))))......((((((.....))))))(((((((.((........))))))))).((((...((((((......)).)))).))))................))))))))).)))).)).)))))..((....))((.(((((((.((((....)))).))))))).))(((((.....)))))......(((((.....(((((.....((...........))..))))).))))).........)))))....))))))).....)))))))..((((......))))..))))))))).)))(((((...((((.((((................((((.(((((....))))).)))))))).))))...)))))...(((((....))))))))).)))...)))))).))))..((((.((((....((((((((...)))))))))))).)))).))))).))))))))))..)))).......((.(.((((((.((((...........)))).))))))).))...(((((..((((((((((((..((((((..((...)).))).)))..)))))))))))).)))))....(((((((....((((((((((.......)))))(((.((.((...(((((.(........)..)))))...)))).)))..)))))....))))))).((..((((((..(((((.....))))).))))))..))....(((((((......))).)))).(((((((((((((........))).................(((((((....((((....))))(((((((.(((((((....((((.......(((((..((((((((((......(((..((......((.((.((.((........)).)))).))......))..)))))))))..............(((((........)))))...))))..))))).......))))...))))))).))).))))........(((.(((..((((((((.((((((((...)))))))...((((.((...(((((((((((((...(((.(((((.((..............)).))))))))...)).))).))).)))))....))..)))).....).))).)))))..))).)))..(((((((((....))))))))).)))))))..))))))))))((((((((...........)))))))).....)).))))..........))))))..)))))))).....))))..))).......))))))).)))).)).)))))).))))).))))))).((((((.......))))))...((((.((((((((((((((.(((.(((((((((......))).)))))).))).))))).......(((.((((((..(((.....)))...)))))).))).......(((((..(((......))))))))........))))))))).))))...
Thermodynamic Ensemble Prediction
(((((((((((((((.((...)).)))))),(((((......)))))}.(((....((((((((((.((((((((.(((.(((((((,,((,((.(((((((((.((((((.(((((((.........((((.((({(((((({...,.((((((((({({(({{.((((((......)))))){((((,,,{|}},||},}..)))}|))))}}}},,|{|||..,}))},,,).}),)))}|||.((((((((((.(((.((..((.(.{({..(((((((((((((((((..,...}..))))))))(((((((((((((.(((....,))}.)))))))))))))((((....)))).))).)))))).},,).}))..)).))).))))...)))))).}))))))))..,))).))))..))))))).))))))))))))))).))}}{({,((((...)))),,))}},((((((...))))))((((((....))))))(.((((((((((((({.....).))))).((((,.....,.}))),.(((((((((.((((.(((((((,(.{(((((((((..((((((,(((((((((..(((({{(,((,,,.((,{((((((...((((...))))..)))).)))))})))),)))))))))),.,),).))))))..,..)))).))..{{,,,,..,,...,{{{((.(({...})).)).))))))))))..).)))))))..)))).}.)))))))).{{||(((((....))))))))((((((((((((.....)))))))}(((((({...})))))),)))).)))))))).).{..(((((.(((((((....)))))))))))),}}|..,||..{{{{.|||,,......}}}.}}}}.....)))))))))))))))))}.((((({{..((((....))))..))..)))))........)))))))))))))...(((((.(((....)))))))).(((......)))...)))))))))(((((((.(((((.(((((,.,.....}}|||{(({{{{{{||{{{{.....,,((.(((((((((({.(((((({...({.(....}.}),}}.)))})....))).}})))))).))..,,....,,{{{,...{(,{{{,,{{,|,..,}||||.,,......(((({{,{{,,({(((({(((,...,{{.,(((((....))))),,.,.,|||,.|||,,,.,.,||....,}||||..,.}}}}}}}}}},,||||||{|,|{{{,{{{{{{.....|||,,,..||}||||||||,..,(((((({.......,.)))))))|(({{{{{{{{||..{{{.(((((.......)))))..,}}{((((({,({(((((......)))))||,.,(({{..,,,,)))(((,....,,,}}},{{{{{{{..{{{{{{{{{,..|{.,{{{{.,,,,,,.}|||....{{{,,{,,{...{{,}||}}||||.||||||},....,}}))}}}},{|||||,||,|{{..,,,,,,))),))}}})))}}|||||||||{|,|||,|||{..(({({((({,{{,{||}},...,,.,(((((,.{{{,,..{({({.,.((((({{..{{{{{..{({(((((((({.{{..,{{|{|{{{{{|||}|.,.}|.|,{,..||,.}}))}))})}.||||,{|,{{{|}}|||||||||.||,|,.,}},)))),,,,|{{{{.,,...,,))))}.,,,,,||}|,||||...}}}},|||||||||..||,|}}}}}}}}},.{((((((((((.(((({...))))))))))...)))))))).}))}})}}))))|{||{{|||||,|.{{{||||||,||,,,,,.,||||,....(((...(((((((((.,...{(((,...|||}....(((((((..,,..(((((((..,(((((...(((((.((.((((.{{{,...((((((..,,,((((((({...)))))),))},||,,..,,,{{{.{{{..{.{((.((((....(((((((......)))))))..)))).))}|,,,|||||{({.{{{{{,.(((...)})}}|))}.))))||||.,,|{{,|{{.,...{.((((.{((((,||,((,.....}}.,...,.))))),)))).|,{{..}||{|||{{,{{{||{}}},.|||}..},,...,}},}})})),,},})}.)))).)).))))),{(({,..}}{{.(((((((.((((....)))).))))))).},(((((.....)))))......{((((.....(((((...,{,.......,....}...))))).))))).......,.)))))..,.)))))))..,..)))))))..{{||....,,))}}.,))))))))).))){{{{{,,|||(({({({........,.......((((.(((((....))))).)))).,}}|))}}||.}}}}}...(((((....))))))})),))}.|.}}}))).}}}},.((({.{(((....((((((((...}))))))))))).)))}.}}))).)}}}}}||||{,|||{..,{{..((.,.((((((.((((...........)))).)))))),.}}..,{((((..((((((((((((..((((((..(,...)}.))).)))..)))))))))))).)))}|,{{{((((({(,,,,{{.{{(((((.......))))}{{{,{{|||..}||||{.|},}}},..,,})}})}...||}}||||,,||,||,{{,|},||||{({{{({{(((..{((((,,,..}}})),))}}}}..||,,{{((({,((...,,,|}}.}))).,{{|||||||{|||||,....,||{{..{{{......}}}.||||{{{.,..{{{{||,|}}||,{,,{{,.{{{||||.,|.||||,}}}}},{{||{..{|||{{|{{{|.....,{{..{{,.,,..|{.{,,{{.{{.......,)).)))),)}...,|||,.,,}})))))).....,,.......(((((,.......}}))),,}))}},.))))),.,,,.,)))},,,)},||||{|||....}}}}}}}},||,,|}},}},..||||,.{((((((...}))}}||..,{..,.|)),)))||||||||||,}}}||}}|||||}||||,,......,||,||.||||||||,..|||}}},||||,||||..|.,}..),,))}|,{{|||}||...}}}.}),))},,(((((((({....)))))))))..,||}....,}})}}|||,((((((((|.........})))))))).))},||.,,})}}},..,,,.}))))),.))))))))||||,},,,,|}}||,.}...})))}}}.|)}}.,}.)))))}.))))).))))))).((((((.......))))))...((((.((((((((({((((.(((.(((((((({......})),}))))).))).))))),......(((.((((((..(((.....)))...)))))).)))...,,,.(((({{,{((......))))))))........))))))))).))))...

Transcripts

ID Sequence Length GC content
GUGAACUUGGAACCUGGCGGUGCGAGGUUCUCGCCGGGGAUGCGGCGGC… 3720 nt 0.5067
Summary

Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in this gene are associated with susceptibility to cerebral infarction. [provided by RefSeq, Sep 2015]

Forensic Context

A study in humans identified the PRKCH as a diagnostic/prognostic biomarker for neonatal sepsis, with elevated serum levels in affected patients [Li et al. DOI:10.1038/s41598-025-99619-z]. In a porcine model of bromine-induced skin injury, the PRKCH was significantly increased at 7 days post-exposure and was involved in multiple signaling pathways including IGF-1, insulin receptor, neuregulin, NRF2-mediated oxidative stress, and Toll-like receptor signaling [Price et al. DOI:10.1016/j.toxlet.2008.08.007].