Basic Information
MANE select
Secondary Structure
Secondary structure that contributes a minimum of free energy.
Thermodynamic properties of the Boltzmann ensemble.
Structure Prediction
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCCCACAGAGUUCCACCUGCUCACAGGUUGGCUGGCUCAGCCAAGG… | 399 nt | 0.5338 |
Summary
Predicted to enable DNA binding activity. Predicted to be involved in chromosome organization and spermatogenesis. Predicted to act upstream of or within nucleus organization and spermatid development. Located in cytosol and nucleoplasm. [provided by Alliance of Genome Resources, Jul 2025]
Forensic Context
A study in human seminal fluid stains on laundered fabrics demonstrated that the mRNA marker PRM1 was the only semen-specific marker reliably detected alongside 18S rRNA in stains laundered at 40°C on both cotton and synthetic fabric, but it was not detected in stains laundered at 60°C [Kulstein et al. DOI:10.1016/j.fsigen.2018.06.017]. This research compared modular DNA/RNA extraction methods and found that mRNA profiling for body fluid identification was only possible for stains washed at 40°C, where PRM1 proved to be a stable and detectable marker for seminal fluid identification under those specific laundering conditions. A study in humans evaluating mRNA for cell type identification referenced the PRM1 as a semen-specific gene in the method by Juusola and Ballantyne, and it was amplified on target cell types only in the dataset from Roeder et al. [de Zoete et al. DOI:10.1016/j.fsigen.2015.09.007]. Another review noted that the PRM1 mRNA has been evaluated for forensic body fluid identification [Courts and Madea DOI:10.1016/J.Forsciint.2010.07.002].