| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCGCGCCCGUCCGCCCGCCGCUCCGCGCUCCACCCAGCGCACCCGGGC… | 1555 nt | 0.4212 | |
| GCCGCGCCCGUCCGCCCGCCGCUCCGCGCUCCACCCAGCGCACCCGGGC… | 1492 nt | 0.4229 |
This gene encodes a protein expressed in the suprachiasmatic nucleus (SCN) circadian clock that may function as the output component of the circadian clock. The secreted form of the encoded protein may also serve as a chemoattractant for neuronal precursor cells in the olfactory bulb. Proteins from other vertebrates which are similar to this gene product were isolated based on homology to snake venom and secretions from frog skin, and have been shown to have diverse functions. Mutations in this gene are associated with Kallmann syndrome 4. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in humans identified the PROK2 as a core ferroptosis-related diagnostic biomarker for heat stroke, with its altered expression potentially representing an endogenous protective mechanism that limits ferroptosis by inducing Fbxo10-mediated degradation of ACSL4, and validation via ROC analysis on a patient cohort showed an AUC of 0.976 [Yin et al. DOI:10.1186/s12920-025-02188-3]. A separate study in mice demonstrated that the PROK2 transcript, categorized as a pro-inflammatory cytokine, increased in relative abundance within 1 hour postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].