| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCCGCCGAGGCUCGCUGGGUCGCUGGCGCCGCCGCGCAGCACGGCUC… | 3372 nt | 0.3953 | |
| GUUCCGCCGAGGCUCGCUGGGUCGCUGGCGCCGCCGCGCAGCACGGCUC… | 3468 nt | 0.3924 |
This gene encodes a vitamin K-dependent plasma protein that functions as a cofactor for the anticoagulant protease, activated protein C (APC) to inhibit blood coagulation. It is found in plasma in both a free, functionally active form and also in an inactive form complexed with C4b-binding protein. Mutations in this gene result in autosomal dominant hereditary thrombophilia. An inactive pseudogene of this locus is located at an adjacent region on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
A study in humans demonstrated that the mRNA biomarker KLK3 is a highly effective and specific marker for semen identification, showing over 98% positive detection in both normal and infertile semen samples with minimal cross-reactivity in non-semen body fluids [Tian et al. DOI: 10.1002/elps.202000238]. Furthermore, KLK3 is highlighted in forensic science for its prowess in body fluid identification, and mRNA coding-region single-nucleotide polymorphisms (cSNPs) from such markers, including those within KLK3, present notable advantages for individual identification and deconvoluting mixture stains [Liu et al. DOI: 10.1002/elps.202400077]. A study in humans demonstrated that the PROS1 mRNA is a highly specific marker for semen identification using Real-Time PCR assays, showing no cross-reactivity from blood, vaginal secretion, saliva, or female urine [Nussbaumer et al. DOI:10.1016/j.forsciint.2005.10.009]. The review further confirms the PROS1 as an established mRNA marker for semen identification via RT-PCR, highlighting its role within multiplex assays developed for forensic body fluid screening [Bauer, M. DOI:10.1016/j.fsigen.2006.11.002].