| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCCCAGCCCCCGGCCUAGCUCUGCGAACGGUGACUGCCCAUCCUUGG… | 1800 nt | 0.6344 |
This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin, and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
A study in human postmortem cerebellar tissue demonstrated that the PRPH was analyzed via qRT-PCR as a candidate gene from a microarray screen comparing individuals who died from severe frontal cortex injuries to a reference group [Schober et al. DOI:10.1007/s00414-014-1129-3]. A study in mice demonstrated that the PRPH was the most downregulated gene affected exclusively by formalin-induced inflammatory pain in the primary somatosensory cortex one hour after treatment [Erdei et al. DOI:10.3390/ijms26083538].