Basic Information

Symbol
PRPH2
RNA class
mRNA
Alias
Peripherin 2 TSPAN22 Tetraspanin-22 CACD2 Rd2 RDS Peripherin 2 (Retinal Degeneration, Slow) Choroidal Dystrophy, Central Areolar 2 Retinal Degeneration Slow Protein Retinal Peripherin Peripherin-2 Tspan-22 PRPH RP7 Retinal Degeneration, Slow (Retinitis Pigmentosa 7) Peripherin 2, Homolog Of Mouse Peripherin, Photoreceptor Type Retinal Degeneration, Slow AOFMD MDBS1 AVMD DS
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_000322.5
Sequence length
3001.0 nt
GC content
0.5222

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1059.90 kcal/mol
Thermodynamic ensemble
Free energy: -1113.96 kcal/mol
Frequency: 0.0000
Diversity: 720.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..(((((.((......)).)))))....(((((....(((((((....((..(((......((....)).....)))..)).....)).)))))((((((.((((((((....((((((((((((((((.(((..(((.((((((((..(((((.................)))))..(((.((((((.(((((((......))))))))))))).)))..)))))))).)))..))).........(((((((((.((((..........)))).))))).)))).......((((((...))))))..((((.(((((((...((((((....))).)))((((((...........))))))(((((.(((((....(.((((..((((......)))))))).)...))))).))))).))))))....).))))....((((......)))))))).))))))).))))).....))))))))))))))......((......))))))).))))))).((((((((((.((..(((((((((.(((((.(((...((((((..(((((......))))).............))))))...))).)))))..))..)))))))))))))...((((..((((((.(((((.......(..(((((((((((.(((((...........)))))..)))))))))))..).....(((((...((((((((..............)))))))).....(((((((((.(((..(((((((.......(((.(((((..(((....((((((((...(((((((..(((..((((((.....(.(((..((((((((((..((((((((.........((((((((((((((((.....((((((((..((((((((((.(((((........))..........((((.((((((....((((.((....)).))...))...)))))))))).))).))))))))))....)).)))))).....)))))((((((.....))))))..((.((((((((.(((...(((.((((.((((..((..........((((.((((..((.(((((.(((..((.(((.....))).)).))).)..))))))))))..))))..(((..(((.((....)).)))..)))))..)))).)))))))....))).)))))))).))))))))..)))))..))))))))...)))..(((((((((.(((((((.((((((((.((((.......))))))))))))..............(((((.....))))).......(((((.((((...(((.....................((((.((.((..(((((((((..(((((((((.((...)).))).((((((.(((((.((((.(((((......(((((((((((......))))))))).))))))).)))).)))))...(((....((((.(.((((...))))).)))))))))))))...)))))).))))))))))).)).))))((((((((......))).))))).))).)))).))))).....(((..((((((((...(((((((...)))))))..)).)))))).)))((((...(((((...(((((....((((((((......((((........)))).......((((....))))((((.((((..(((((((((..(((((..((((................))))..)))))..))))))))).(((((((((.....(((((((...((((..(((....)))..))))...)))))))))))))))).........)))).)))).....)))))))))))))))))).))))..((((((...))))))(((..........)))...))))))).)))))))))))))))).))).)))))))..)))((((((.....((((.(((((..(((((((((..((((((......)))))).....(((((.....(((..((((......))))..)))....)))))..((((((((((((....))))))))))))((((((((..(.....(((((...((.(((.(((((((..(....((((.((.(....).))))))..(((...))).....((.(((.......))))).(((((((......))))))))..)))))))...))).)).))))))..)))))))).(((((((((((.((((....)))).).......(((((((.(((((.(((((.......))))))))))..)))))))......((((((............)))))).((((.((((((...)))))).))))......))))))))))............)))))))))..)))))))))..))))))...(((..(((.((((((.....((((((((((..((((.(((....)))...))))....))))))))))......(((....)))...........((((..(((((((((((((((((..((.((........)).))..)))..)))))))...)))))))(((((...((((((((..................))))))))....)))))((((((.(((((((((...................)))).)))))...))))))(((((.....)))))..))))((((..(.((((((.(((......((((....))))......))).)))))).)..)))).............)))))).))).))).))))))).))))))))...)))..)))))))))))))))))).))))))))).)))))........))))).))))))...))))......((((....))))((((....)))).........)))))).........
Thermodynamic Ensemble Prediction
(((((((..(((((.((......)).)))))....(((((....(((((((,...((..(((......,{....}},....}})..}}}},..,,.))))){(((({{((((((((....((((((((((((((((,{{{,.,,{{{{{{,{{(((((((((.{(,,....((((((.(((.,..(((.(((((({(,(((((......))))})))))))).)))..))).)))))))}.(((((..,,....(((((((((.((((..........)))).))))).))))..,.,,)))))..}).)))))))}}|||..|{||.((((((.((((((((.(.((((..,.,((((,,(((((((((.,,{(({....}))))}))})))).((((......)))).)))))})})..)))).).)))))))).))))))|}|,.,,{.,|,.,,)))})))))).))))})),))))).....)))))))))))))}......{{......))))))).))))))).((((((((((.,{{.,({{|||{{.({((({{....,}|)|,|,,(((({......}))),.....,,,,{,..({(((,,,.,|},||..,,.))..})))))})}),))}},((((..((((((.(((((.,.....{..(((((((((((.(((((...........)))))..)))))))))))..|.....({{{(...((((((((..............)))))))).....(((((((((.(((..(((((((......,(((.(((((..(((.,..((((((((...(((((((..{{{..((((({.....(.(((..((((((((((..((((((((,,.,...,,||{{{{{((({(((({.....{{|{{{{|,.{(((((((((.((({,....................((((.(((((({,..,.((.((....)).))...,.,}.)))))))))).))).)))))))))|,,,||||}||||}.....}}}}}((((((.....))))))..((.{((((((({((,...(((.((((.((((..((........,.((((.((((..{{.(((((.(((..((.(((.....))).)).))).)..))))})))))..))))..(((..(((.((....)).)))..)))))..)))).)))))))....,}),)))))))}.)}))))})},}))))).))))))))...)))..(((((((((.(((((((.((((((((.((((.......))))))))))))...........,..(((((.,...,}|||...,,,,,{,,{.{((({,,{,......,.....,,.....,|,((((.((.,((,{((((((((,,((((({(((.(,...}}.))).,|||||.(((((.((((.(((((......(((((((((((......))))))))).))))))).)))).)))))...{({....((((.(.((((...))))},))))|}|,,)))),,.})))}}.))))))))))).)).))))((((((((......))).))))).|||.,}}},}}}}}.....|||,.,,||||,,...(((((((...)))))))..}),)))}}|.||},,,,..||{,,....(({{{..||(((((({{|{,,,.((((........)))).,||{|}|{((.,,,}|}|((....}}}..(((((((((..(((((..((((....,.....}}....))))..)))))..))))))))),|{{{{{|{(,,|||{{,{((((((((...)))))))),,|..,..|.||}}|}|,,)))))))))}}|}},....}}}}}})},.,,.},})))))},})),..}}}..((..((((((...})))))..))........,)))...))))))).)))))))))))))))).))).)))))))..}}}((((((.....((((.(((((,.((((((((({,((((((......)))))),}...(((((.....(((..((((......))))..)))....)))))..((((((((((((....))))))))))))((((((((..(.....(((((...((.(((.(((((((..{{{{,((({.,,.|.,,,)})||||,..{((.{{||,.....||}|{|}......)))),.(((((((......)))))))}..)))))))...))).)).)))))}.,)))))))).{((((((((({{(((,....,,,,.,.......{{{{{||,||{((,({{{{,,,,,,,|||}}}}))),,))|}}||,.....,{((((.,..,.......}}}}|||{{{{.((((({...)))))),)))))),}}.)))))))))}.,,.......,,))))))))),.)))))))))..)))))),,.(((..(((.((((((..{{,.{{({{{{(({,||...,||,...,.,.{(((((((...((((({{.(({(({{(((....))).....,{.{,.,(((,.((((((({(({({((((..{(,{{..,,,...)),}}..)))..}))))}}...)))))))(((((...((((((((,,............,,,.))))))))....)))))((((((.(((((((((.,.{{,....,...,,,..)))),}))))...)))))).(({,,,{{{|||||{,...)}))})})})))))))),..,{{{{{.{{{||.,,,}}))),)))},)))))))))))))}))}.,))),....)))))).))).))).))))))).))))))))..,)))..)))))))))))))))))).))))))))).)))))...,,,,,))))).))))))...))))......((((....))))((((....)))).........}))))).........

Transcripts

ID Sequence Length GC content
GGCUGGGAAGGGCGCUGAAGAAACAACGCCCAGGACCAGGACUAUCCCC… 3001 nt 0.5222
Summary

The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human postmortem cerebellar tissue demonstrated that the PRPH2 was analyzed via qRT-PCR as a candidate gene from a whole-genome microarray, which identified significant gene expression differences following severe frontal cortex injury [Schober et al. DOI:10.1007/s00414-014-1129-3].