| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUCUACCACCAUGAAUCCACUCCUGAUCCUUACCUUUGUGGCAGCU… | 809 nt | 0.5365 |
This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
A study in human postmortem tissues from a cancer research autopsy program demonstrated that the RNA integrity number (RIN) of normal tissues declines with increasing postmortem interval (PMI) in a tissue-specific manner, while RNA quality in cancer tissues was highly variable and showed no correlation with PMI [Fan et al. DOI:10.18632/oncotarget.11836].