Basic Information

Symbol
PRSS12
RNA class
mRNA
Alias
Serine Protease 12 Neurotrypsin BSSP-3 MRT1 Brain-Specific Serine Protease 3 Protease, Serine 12 Motopsin Leydin Protease, Serine, 12 (Neurotrypsin, Motopsin) Mental Retardation, Autosomal Recessive 1 EC 3.4.21.- EC 3.4.21 BSSP3
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_003619.4
Sequence length
4809.0 nt
GC content
0.4870

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1576.00 kcal/mol
Thermodynamic ensemble
Free energy: -1667.94 kcal/mol
Frequency: 0.0000
Diversity: 1187.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((..(((((((.((((..((((.(((((((.((.(((((((((...(((((.....)))....))...))).)))))).))..))))))).))))..))))((((((.((((.(((((.(((((((((...((.(((((((((..(((((..(((((.(((((((((((((((((.(((((...((.(((.(......)))))))))))))))))))).((((((.(((...)))..)))))).((((((((..(..((.(((....(((.((((((((...((.((......)).)))))))))).)))..))).))..)))))))))..(((((.((((.((..........................)).)))))))))....)))))))..((((.((((............................))))..)))).).))))).)))))..))))))))).))))))))))).......(((((((((........)))))))))..((((((((((...(((((.(.((((.((((((..(.((((((.(((((((..((..(((...)))..))..).))).....))))))))).)..)))))).)).)).))))))......))))))).)))(((.....))).))))))))).)))))).((......)).........(((((....)))))))))))))))).(((.((((((((....)))))))).).))(((((((((.(((((...((((....)))).((((((((.....)).))))))((..((((......))))...)).....(((.(((.......(((((....((((((..((((......(((((((..((((..((((....))))))))((.((.(((((....))))))).))..(((..((((..........(((((((((((((.(.((((((((..(((((.((.(.(((((....)))))).)).)))))...........(((((.(((.......)))...))))))))))))).)))))..))))))))).((((((........))))))..((((((((((.(((((((((((((((.(((.((((((....)))))).))).)))..((((((((((.......)))).)))))).)))))))).)))).)....).)).))))))...((((..((((((.....))))))))))))))..))))))))))..(((((.....)))))...(((((..(((((((((((((((((((((((((((((.......(.(((((((.(...(((......)))....).))))))).)......((((...)))))))))))))).))))).........(((((((((((.(((((............((((((..(((((......((((((((...(.(((((((.(((((((((.((((((..((((...((((....(.(((.((((.((((((.(((((((.(((.(((.....((...((((((.((.((...(((..................)))...)).)).))))))..)).....))).))).........((((((....(((((((((..(((((((.....(((((.(((((((.((((......)))).)))))))(((.((....)))))...((..........))...(((((...((((.(...).))))...)))))....)))))..))))))).))).))))))..(((.(((((.......((((....(((((.(((((((((..((((....((((((((...(((((((((.((.((((..((..(((((((.((((((.(((((.((..((((((((((((((.((((.((((((.(((........))).))))))...)))).((((((((((((.((((.((........)).)))))))..))...)))))))(((....(((.((...(((....)))...)).)))...)))(((((((...(((((..(((((((((..((.((((((.(((......)))..))))))))..))))).......)))))))))..))))))).........((((.......))))...(((((((((..((((((....((((((.(((((((((((((..((.(((....)))))))))))..))))))).))))))((((((((...(((..(((((((((((((((....(((((((........))))))).(((((.((((((((((.(((..((((((.(((...)))))))))((((((.((((((((((((.(((((....))))).(((((...((((((.(((.((((......((((((.....(((((........))))).)))))).......((((.(((((((((..........))))))..).)).))))((........)).((..((((((....((((.(((.(((...)))..))).)))).....))))))))..(((.(((((....)))))..)))((((((((.((.....))(((((((((((((((......((((((((.((((((..((((..((.(((((....))))).))...))))..((((..(((((((....))))...)))..))))((((((..........))))))..((((.(.....).))))(((((..(((((..(((...((.((((((......)))))).)).))).))))).))))))))))).))))))))((((.........))))))))))).....(((((.......)))))...))))))))....)))))))).)))).)))))))))....)))))((((((...(((((....))))).....))))))....(((((((..((((.........((.((((((...(((((((.....)))))))...)))))).))........)))).....(((..(((((((((((...........)))))))))))..))).)))))))..)))))))))...............)))))))))...((((....))))......))).))))).................((((((...(((........(((((((....)))))))..........)))..))))))..........))))).)))))..((((((((.............((.(((((((((....(((((............((((....))))((((....))))((((((((((...))))))))))..((((.........))))))))).....))))))))).)).....(((((..........)))))......)))))))).....))))))).))..))))))..))).....)))))))).......)))))).)))))))))(((((((....)))))))))))))..))..)))))))).))))).......(((...........)))...))))))))))...(((((.((((((....)))))).(((((......))))))))))........)))..))..))))........................(((((.....)))))))))))))))).....)))))))).))))...))))))..)))..)))))....))))((((((.............))))))))))))))...)))))).(((........)))..........))))))).(((((...((((((........(((...(((.((.....)).)))..)))........))))))....)))))..(((....))).)))))).)))).))).)....)))).))))(((....)))...((((..(((((((........))))))))))))))))).))))))...(((((.....))))).............((((((((....)))))))))))))))))))))))))))......)))))..))))))((((((((((..........))))))))))((........)).....))))).)))))).)))))....((((...........))))....((.((((......)))).)))))))))))))))).(((.(((.......))).)))(((((((((....((((.........))))....))).))))))..)))))..........))))..))))))))))).......))).)))...........)))))((((((......((.((((((........(((((...((((((((....((((((....((.((((((((...((((((......))))))...((....))......(((......)))............))))))))))..)))))))))))))).....)))))......)))))).)).....))))))...(((((......((((((((....((....))...))))))))..((((((((....((((...))))...))))).)))...(((((.......))))).(((((..(((((((.....((((........))))...)))))))...))))).(((((((.((..((...((((((((((............)))))))....)))...))..)).))))))).)))))..(((((((......)))))))...)))))))))..
Thermodynamic Ensemble Prediction
.,(((.{(((((((,{{.,...,((,(({,....{|||||{(((((({{{{({{{{{,{|,{...,{,,...,,{|({||{{|}{,{||||,,,||}|{{{,|{{(((({{((({...,((.(((((((((...((.(((((((((..(((((..(((((.(((((((((((((((((.(((((...((.(((.(......))))))))))))))))))))}((((((.(((...)))..)))))).{(((((((..,..{{.{{(,,,.(((.((((((((...((.((......)).)))))))))).)))..}},.))},})))))))|..(((((.((((.((,....,,,......}},.........}}.)))))))))...,)}}}}}|{{{(((,{{{,....................,,,,.},,)})))))))}.,.))))).)))))..))))))))).)))))))))))||,,...{{||||||{,,,,,,,.}))))))))..|||||||.((((((((....)}}}})))){,,|||}}|)|||,||||||||}||}.{{({{{|||,.||{{|.|||...,}}})))}|||{|{|||||||,}||||.|||}||,.,{,.|||}},|||||{(({{{{.|{||||||,}}})}))))}|.}|...{{{||.........(((((....)))))))))))))),),|||.((((((((....)))))))).).}||{|||{||{,|||{|||.||||.,,,)))),|||||,,,.....))|}})))}}|,,|{,,...,,,,}})},)}),,.|||||.}||..{(((((((({,..{(((({{{{{{{{{{,{{,({,,{((((((((..((((....})))}}},}|}||.||||{.,,.)))))}},((((((({...............,((((((((((,,,((((.((.((((,,.....,))}}.}|.))))).,,)).))))))))...........(((((.{((,......})),..))))){|,{(((({.(((((..||.{{((((((((((........))))))..(((((((({{((((((((((((((((.(((.((((((....)))))).))).))),.((((((((((.......)))).)))))).})))))))},))},).}..}.)),,))))),{{((((..((((((.....)))))}|||}||||.|||}},}||}|..||||{..,,.)))))}},{{{{{..,((((((((((((((((((((((((((((,,.......{((((((.{...(((......)))....}.)))))))})......((((...))))}))))))))).))))}....{{{{.{,((,(((((({(((,((((((((...))).))))},{{{{{.,.,..((((((({..,{.(((((((.((({(((((.((((((,,{(((,,,{(((,.,.{.(({,{{{{,|||||{.{(((({{.{{{|||{.....{,...{((({(,((,,,...{({,,.,,......,|||...}}},|.}}.}||}}||||,,,,..,,,||{,.||{{{,,,,,.((((((.,..(((((((((..(((((((.....(((((.....{(.(((((((.,,({.(((.(({{.(((((((.{{(((,{,...,,...,.))},}})),,)))).}}.))))).}}})..))))))).}}.....))))).,))))))).))).))))))..{((.(((({.......((((....(((((.((((((((({,{(((....{(((((((...(((((((((.((,(((({{((({((({{(({(,((((.(((,(,(({{((({(({{,{{,{(,((((.((((((.(((........))).))))))...}))}.{(((((({,(((.((((.((........)).)))))))..}}...))))))}|||}}}}.(((((......)))}).},.}))}))).)})),(((((((...(((((..(((.(({((,,({.((((((.(((......)))..))))))}}..})))}.,}.)}),,..)))))..))))))).........((((.,....,))))...(((((((((..((((((....((((((.(((((((((((((..((.(((....)))))))))))..))))))).))))))((((((((...(((..(((((((((((((((....(((((((........))))))).(((((.(((((,(((({.((..((((((.(((...)))))))))((((((.((((((((((((.(((((....))))),(((((...((((({{(((.((((......{{((({.....(((((........))))).}}}}}|{{...,{{(((.(({((((((..........))))))..}.)).)))){{.....,,.}}.((..((((((....((((.(((.(({...}))..))).)))).....)))))}))..(((.(((((....)))))..)))(((((((({((.....))|{{{{{{((((((((......((((((((.((((((..{(((,.((.(((((....))))).)).}.)))}..((((,.(((,{,{{,...})).}.)))..))))((((((..........))))))..((((,,.....).))))(((((..(((((.,{{{...((.((((((......)))))).)).)))}))))).))))))))))).))))))))((((,....,,..))))))))))),...,((({(.......}}})).,.})))))),....)))))))).)))).)))))))))....)))))|(((((...(((((....))))).....)))))}....(((((({..{((({,,,,,|,|,|.((((((...(((((((.....)))))))...)))))){||{........,.)}}}..|||,,(((((((((((...,......,)))))))))))..})),)))))))..))))))))).......,.....,})),)))))).......,{(({{{,,,||,,})),)}}}}.......,,.,}}},..((((((...(((........(((((((....)))))))..........)))..))))))..........})))).))))),.((((((({.............((.(((((((((....(((((............((((....))))((((....))))((((((((({...}))))))))}.,{({,.........,,,,})))).....))))))))).)).....(((((..........)))))......))))))))},...))))))).))..})))))..))).....)))))))).......)))))).))))))))){((((((....)))))))))))))}.}}|.))},}}}}.,}}},.......{{{,..,,,..{{{{{........{{,,,....,,.}}.......}}}}).,))}{(((((......)))))).||{,.......,,,..},,,))))...........,,...........(((((.....)))))))))))))))).....)))))))).))))}}}),})))..)))..)))))....))))((((((.............))))))))))))))...)))}}}.|,,...,,}}}}},..........|||}||,.{({({.,,{(((((,{......,{....((,.,,.........|}.,}},........)))))).,..))))}..||}},|,|||,}}}}}}.}}}}.)}),),,..)))),),}},,|...,))}...||||}}|||||||..,,,,.,)}}}})}))}})))))).,))))),..(((((.....))))).............((((((((....)))))))))))))))))))))))))))....}.}})}},{{{{{.{((((.{{{,,..,},})}}}))))).||}|((........)),.,,..,,||.,}}}}}}.||||,...||||..........})),)})))}.,|||,}}}}..}},,..))))))))))))))},(((.{((.......))}.)))|((((({({.,..((((.........))))...,)}).)))))}..})))).})).))..)))))..)))))).)).............)))))))).,....))))},{{{||,.,...{{.((({{{........(((((...((((((((....{(((((....||,|{{{((((,..{{{(((,,....)))}}}....,.|||||,,,,.,,,,...}}})}},,,...,},...)))))))},}..))))}})))))))).....)))))......)))))).,},..,,)))}},...(((({......((((((((....((....))...))))))))..((((((((.{,.{({{...})}),,.)))))},))...{((((,.....,))))}.(((((..(((((((.....((((........))))...)))))))...))))}.(((((((.((..((...((((((((((............)))))))....))).,.))..)).))))))).)))))..{((((((......))))))}...)))))))))).

Transcripts

ID Sequence Length GC content
GCUGCGUCCGCGCCUUCUCUUUUCCGGUCCUCUCCGCCGGCCGGGGCUC… 4809 nt 0.4870
Summary

This gene encodes a member of the trypsin family of serine proteases and contains a signal peptide, a proline-rich region, a Kringle domain, four scavenger receptor cysteine-rich domains, and a trypsin-like serine protease domain. The protein, sometimes referred to as neurotrypsin or motopsin, is secreted from neuronal cells and localizes to the synaptic cleft. Studies in mice show that this protein cleaves a protein, agrin, that is important for the formation and maintenance of exitatory synapses. Defects in this gene cause a form of autosomal recessive cognitive impairment (MRT1). [provided by RefSeq, Jul 2017]

Forensic Context

A study in rats demonstrated that the PRSS12 is a developmentally-regulated, methamphetamine-responsive gene transcript isolated from the neocortex, showing pharmacological responses such as D1 antagonist-sensitive upregulation similar to the novel transcript mrt3, and is associated with behavioral sensitization [Yamamoto et al. DOI:10.1016/J.Euroneuro.2014.07.010].