| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUCUACCACCAUGAAUCUACUUCUGAUCCUUACCUUUGUUGCAGCU… | 851 nt | 0.5417 | |
| ACACUCUACCACCAUGAAUCUACUUCUGAUCCUUACCUUUGUUGCAGCU… | 809 nt | 0.5513 |
This gene belongs to the trypsin family of serine proteases and encodes anionic trypsinogen. It is part of a cluster of trypsinogen genes that are located within the T cell receptor beta locus. Enzymes of this family cleave peptide bonds that follow lysine or arginine residues. This protein is found at high levels in pancreatic juice and its upregulation is a characteristic feature of pancreatitis. This protein has also been found to activate pro-urokinase in ovarian tumors, suggesting a function in tumor invasion. In addition, this enzyme is able to cleave across the type II collagen triple helix in rheumatoid arthritis synovitis tissue, potentially participating in the degradation of type II collagen-rich cartilage matrix. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2015]
A study in human whole blood from septic acute kidney injury patients identified the PRSS2 as a key hub gene within the protein-protein interaction network of the disease's regulatory ceRNA network [Ma et al. DOI:10.3389/fgene.2023.1209042].