| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACACCCUGACCCGCAUCGCCCUGGGUCUCUCGAGCCUGCUGCCUGCU… | 1383 nt | 0.6377 |
This gene encodes a member of the trypsin family of serine proteases. The enzyme is expressed in the airways in a developmentally regulated manner. The gene is part of a cluster of serine protease genes on chromosome 16. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the PRSS22 gene was significantly up-regulated in skin following ultraviolet-B-induced inflammation, with a fold change of 17.1 in human and 3.6 in rat skin [Dawes et al. DOI:10.1371/journal.pone.0093338]. In a separate investigation of mild traumatic brain injury in rats, the PRSS22 gene exhibited a time-dependent expression pattern, being down-regulated at 12 hours post-trauma and subsequently up-regulated at 48 hours [Colak et al. DOI:10.1016/j.injury.2012.01.021].