Basic Information

Symbol
PRSS8
RNA class
mRNA
Alias
Serine Protease 8 CAP1 Prostasin Channel-Activating Serine Protease 1 Channel-Activating Protease 1 Protease, Serine 8 EC 3.4.21.120 EC 3.4.21.- EC 3.4.21
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Tissue/body fluid identification

MANE select

Transcript ID
NM_002773.5
Sequence length
1837.0 nt
GC content
0.6249

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-788.20 kcal/mol
Thermodynamic ensemble
Free energy: -816.44 kcal/mol
Frequency: 0.0000
Diversity: 606.32
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((.(.(((((((((..(((.(((((((((((...((((((((((.((((((.(((..((((...((((...)))).((((((((......((((........))))..((.(((.((((....))))...)))))......((((((........))).)))..))))))))((((.((..(.((.((.((((((.(((((((((.(((((...((((((....)))))).))))).)))))))))..((((...(((((((.(((((((...((((((((((((((.......(((((((((.(((((.....((((((((.(((....((((((((((.......)).)))))).((((((((.(((((((.((((..((((((.(((((((((((((((((...((((....((((.(((.....(((((((.....(((((....((((((((((((((...))).))))))))))).....)))))))))))).))).))))...))))...)))))((((((.((((.....(((.......)))(((......)))(((((((((.(((.(.((..(((((..(((((((.((((.(((..(((((...(((((...((((((..((((.(((...((((.....((((((..............(((......)))....(((((.....(((............))).....)))))(((.((.((((((((((((.(.((((........).))).).)))).))).))))).)))))......))))))..))))...))).).)))..)))))).)))))..........)).)))...)))))))(((((((((.(((((....))))).)))))).))))))..)).))..)))))....)).))))..))))))).)))))))))))).....))))))......)))))).)))..)))))))..)))))))..(((((((.....(((((((((((((((..((((.(((.((......((((((((...(((.((((....))...)).))).))))..)))))).)))))))..))))).))))))....))))..)))))))((.((((......))))))..))))))))))....))))))))))).((((((((((.....(((((((...............)))))))))))))))))))))).)))))..(((((((......))))))))))).....))))))))))).))).....((((((..((((..((((((((...((....)).....))).))))).)))).))))))......((((((.(((....))).)))))).(((((((...(((((.(((((((((.((((..((((((((.((...((((((.((((..(.((((.((((........(((.....)))..(((((((...))))))).........((((((......))).)))..(((((((...))))))).(((((.((..((((((....)).))))..)).))))))))).)))).)..)).)).))))))...)).))))))))..)))).(((((.......(((((..(((........)))..)))))......))))).)).))))))))))))..)))))))...........))))))).....))))))).)))).)))))).)))).).))))))..)))).....))).))).)))..))))))))))))))))))))))))....)))).))............)))).)))))..
Thermodynamic Ensemble Prediction
.,.{{(((,(((.,,,,.,.}}}}||||{||(((({(((,..||||((((,({(,,,,,((((({(({.{{{{{{..{|.|||{{||{.,|||({(,,(((((((((.....(((((((({{.((((....))))...}},,,...}))))))),..(((({.(........}.}))))......,,.{((((((.(((.{{{,(((((((((.(((((...((((((....)))))).))))).)))))))))..}))).((.(((((((.{{,((.(((((((((.((((.((((.....)))).))))..))))))))).}),)}..})))))).}}(({,,,||}..}}}.))})))),,..))).)))))))))).,}}},,,|}|{{{|||||,,||||||..|||....,,..||,.((((((((((.(((.((((((((((..(((...((((((((((((((...))).))))))))))}.(((((.((((({{((..(((((.{{..(((((((((.(((((,(({.|{|{(|.|||((((.....{|||{,{{,,{{|||{{,.,(((({((({,.,,.,{|,,{,{{{{{(((.{{{{{{{{|{((((({{{(((({.,.({((((,,({((,,((,,.((({..,..(({{,,.....,,,......(((......}}}.,,,(((((.....(({,,,,,,,,,...}}|,,,,,|}||,(((.((.((((((((((((.(.(((,,.....,.).))).).)))).))),})))).)))))......}||||},.||}|...,||,|.}}},.|||||}.,,,.,}},,..,.,,}},)},..,))))})}|||((((((.(((((....))))).)))))).)))})}|.,)}))}}))))),},|}}.||}}}||}))),}.}}}|||||||||{,{{{{{,|||||,.}}})|},..,|}},..,}},.|||{,..,}|||{|||||||,|,|{{{(((((((((({..((({{(((,{(,,.|||{{({{||({{,(|...,,,..)))))..,,.})).,)))),)},,,|.))))))).|))))).))))))....}}}},|}}}},(((,.{(((......))))|||,{{{....|||{,,||||,,,||||..,,,,,||||..}}}||||}}{{.||....,|||}}.,})))||,||||||{||||,,,,..,,.,..|||||||......}})))))))}}}.....,})))||)),,)}}}}...{(((((..((((..((((((((...((....)).....)))}})))).)))).)))))),....}}})}},,}))).,}},),)))))),)))),))))).)))))))))..}),...,.)))))..)))))))).)))))..,,.))).))))))(((((((...))).)))).......(((((((...)))))))...))))))))))))))..)))....||{{(((((((...))))))).(((((.((..((((((....)).))))..)).)))))(((({{{((.((((.((((.,..(((((.,..(((((((,.{,.({({{({......}}..}}}.....,.},})))))).,)))))......}.)))))))).))))))))...|}}}.....,,,)))....))))))})),))}}...,.(((((({(((({..{(((((({...{{{(((,{{..{{|.....))}..)),)))))).))))))))))))))..)))))).,............,}}}}}))),,..

Transcripts

ID Sequence Length GC content
AGACGGUGCUGGUGACUCGUCCACACUGCUCGCUUCGGAUACUCCAGGC… 1837 nt 0.6249
Summary

This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation. [provided by RefSeq, Feb 2016]

Forensic Context

A study in human and mouse models demonstrated that the PRSS8 (CAP-1) is a potential diagnostic marker for sepsis, where single-cell RNA sequencing revealed a specific augmentation of Resistin signaling in sepsis monocytes mediated via the RETN-CAP1 ligand-receptor pair [Li et al. DOI:10.1016/j.intimp.2024.111938]. Prostasin is a protein marker found in saliva for body fluid identification [Alex et al. DOI:10.1016/j.scijus.2025.101320].