| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACGGUGCUGGUGACUCGUCCACACUGCUCGCUUCGGAUACUCCAGGC… | 1837 nt | 0.6249 |
This gene encodes a member of the peptidase S1 or chymotrypsin family of serine proteases. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate via a disulfide bond to form the heterodimeric enzyme. This enzyme is highly expressed in prostate epithelia and is one of several proteolytic enzymes found in seminal fluid. This protease exhibits trypsin-like substrate specificity, cleaving protein substrates at the carboxyl terminus of lysine or arginine residues. The encoded protease partially mediates proteolytic activation of the epithelial sodium channel, a regulator of sodium balance, and may also play a role in epithelial barrier formation. [provided by RefSeq, Feb 2016]
A study in human and mouse models demonstrated that the PRSS8 (CAP-1) is a potential diagnostic marker for sepsis, where single-cell RNA sequencing revealed a specific augmentation of Resistin signaling in sepsis monocytes mediated via the RETN-CAP1 ligand-receptor pair [Li et al. DOI:10.1016/j.intimp.2024.111938]. Prostasin is a protein marker found in saliva for body fluid identification [Alex et al. DOI:10.1016/j.scijus.2025.101320].