| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGACCCCACCAUGGCUCACCGGCCCCCCAGCCCUGCCCUGGCGUCCGUG… | 987 nt | 0.6646 |
Enables enzyme binding activity; serine-type endopeptidase activity; and signaling receptor binding activity. Involved in several processes, including mature conventional dendritic cell differentiation; neutrophil extravasation; and positive regulation of GTPase activity. Located in azurophil granule lumen; cytosol; and plasma membrane raft. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the PRTN3 as one of 19 center genes commonly differentially expressed in blood across early-stage, middle-stage, and control groups following burn injury, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0]. In mice, single-cell RNA sequencing following traumatic brain injury with clodronate pre-treatment revealed the PRTN3 as a defining granule gene for a neutrophil-like monocyte cluster, with its increased expression in whole blood monocytes correlating with a neuroprotective phenotype and improved injury outcomes [Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8].