| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGACUCUCACCGCAGCGGCCAGGAACGCCAGCCGUUCACGCGUUCGG… | 2068 nt | 0.4270 | |
| GCAGACUCUCACCGCAGCGGCCAGGAACGCCAGCCGUUCACGCGUUCGG… | 2206 nt | 0.4248 |
This gene encodes a member of the class-V pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is a phosphoserine aminotransferase and decreased expression may be associated with schizophrenia. Mutations in this gene are also associated with phosphoserine aminotransferase deficiency. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 1, 3, and 8. [provided by RefSeq, Jul 2013]
A study in humans demonstrated that the PSAT1 mRNA marker, which encodes prostate-specific antigen, is a highly effective and specific indicator for semen identification, showing over 98% positive detection in both normal and infertile semen samples with minimal cross-reactivity in non-semen body fluids [Tian et al. DOI:10.1002/elps.202000238]. Furthermore, a review of forensic mRNA applications confirmed the PSAT1's high efficacy for semen identification and noted that mRNA markers, including those for semen, are stable and detectable in aged forensic stains, with coding-region SNPs enabling individual donor identification from body fluids [Liu et al. DOI:10.1002/elps.202400077]. A study in humans demonstrated that the PSAT1 mRNA is a highly specific marker for semen identification using Real-Time PCR assays, showing no cross-reactivity from blood, vaginal secretion, saliva, or female urine [Nussbaumer et al. DOI:10.1016/j.forsciint.2005.10.009]. Research indicates mRNA, including markers like the PSAT1, can be extracted from dried stains stored for years and is suitable for multiplex PCR assays to screen for body fluids, supplementing DNA analysis in forensic cases [Bauer DOI:10.1016/j.fsigen.2006.11.002].