Basic Information

Symbol
PSMB4
RNA class
mRNA
Alias
Proteasome 20S Subunit Beta 4 PROS26 HN3 Proteasome (Prosome, Macropain) Subunit, Beta Type, 4 Multicatalytic Endopeptidase Complex Beta Chain Proteasome Subunit Beta Type-4 Proteasome Subunit Beta 4 Proteasome Subunit Beta-7 26 KDa Prosomal Protein Proteasome Beta Chain Macropain Beta Chain Proteasome Chain 3 HsBPROS26 PROS-26 Beta-7 HsN3 Testis Tissue Sperm-Binding Protein Li 79P Proteasome Subunit, Beta Type, 4 Proteasome Subunit Beta7 Proteasome Subunit HsN3 Proteasome Subunit Β7 EC 3.4.25.1 PRAAS3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002796.3
Sequence length
918.0 nt
GC content
0.5196

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-313.10 kcal/mol
Thermodynamic ensemble
Free energy: -330.80 kcal/mol
Frequency: 0.0000
Diversity: 203.20
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((((.......)))).)))......(((((((.((...((((.....(((((((((...)))))............)))).....))))...)))))))))(((.(((((...(((((((.........(((((((.......(((.((((........))).).)))))))))).(((((((((.....).))))))))(((((.((((((.(.(((....))).).))))..)).)))))..(((((.((((((........((((((...))))))...((..(((((...))))).))(((((((((((..((..((.((((........)))))).))..)).)))))).)))....((((((.((((.((((((.((((......))))..)))))))))).))))))(((((((......)))))))..((((.(((.(((...(((((.((....((((....))))))))))).))))))..)))).)))))))))))..((((((.....((((((((((((((((((((((.(((.....((((.((((..(((((.((((((((...(((((..((.(((.(.((.....))...).))).)))))))))))...))))))))).)))).))))))).))))...))))))).)))))).))).))))))))..(((.(((.....))).)))((((((..((((((((((((......)))((((........((((....))))........))))((((......))))...)).))))))))))))).......)))))))...)))))))).(((((......((((((((.(((((((((.....))))))))).))))..............))))........)))))......
Thermodynamic Ensemble Prediction
((,,(((({{{{{{{|||,.,,)}}}}}.,,|||||}||}..(((,..{(((((((((((...})))).{{{,.,.....},,,...)})))),..))))},}}}{((.(((((...(((((((...,,,...(((((((..,,,{.,((.,,,,.....,,.}})})},,}))))))).(((((((((.....),})))))))(((((.((((((.(.(((....))).).))))..)).)))))..(((((.((((({........((((({...})))))...,...(((((...})))),}|(((((((((((..{{{{((.{{{{.,......}}))),.))..}),}))))).)))....((((({.((({{((((((.((((......))))..)))))))))).})))))(((((((......)))))))..((((.(((.(((...(((({,((....((((....))))))))))).))))))..)))).,))))))))))..((((((...{{(,{{,{((((((((((((((((.{((.....((((.((((..{((((.(((({{{(,,,(((((..((,(((,(,{{.....))...)}))}.))))))))))}...))))))))).)))).))))))}.))))...))))))).)))))}.)})}),))))))..(((.(((.....))).)))((((({..((((((({((((......)))|,{,.......,((,{,..,||||.,,,....,,,)||||,,,..,))),...}}.)))))))}))))},},,...)))))))...)))))))}.{(((({.....,|||{{{{.(((((((((.....))))))))).,|||.....,,,,,|.,}}}}}........}}})),,..,,

Transcripts

ID Sequence Length GC content
GCUACCGUGACUAAGAUGGAAGCGUUUUUGGGGUCGCGGUCCGGACUUU… 918 nt 0.5196
Summary

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the PSMB4 as a housekeeping gene with highly uniform and strong expression across 16 normal tissue types, including brain, liver, and skeletal muscle, based on RNA-seq analysis [Eisenberg and Levanon DOI:10.1016/j.tig.2013.05.010].