| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUACCGUGACUAAGAUGGAAGCGUUUUUGGGGUCGCGGUCCGGACUUU… | 918 nt | 0.5196 |
The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. [provided by RefSeq, Jul 2008]
A study in humans identified the PSMB4 as a housekeeping gene with highly uniform and strong expression across 16 normal tissue types, including brain, liver, and skeletal muscle, based on RNA-seq analysis [Eisenberg and Levanon DOI:10.1016/j.tig.2013.05.010].