Basic Information

Symbol
PSMB7
RNA class
mRNA
Alias
Proteasome 20S Subunit Beta 7 Z Proteasome (Prosome, Macropain) Subunit, Beta Type, 7 Multicatalytic Endopeptidase Complex Chain Z Proteasome Subunit Beta Type-7 Proteasome Subunit Beta 7 Proteasome Subunit Beta-2 Proteasome Subunit Z Macropain Chain Z EC 3.4.25.1 Beta-2 Epididymis Secretory Sperm Binding Protein Proteasome Catalytic Subunit 2 Protein Serine Kinase C17 Proteasome Subunit Alpha Proteasome Subunit Beta2 Proteasome Subunit Β2
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_002799.4
Sequence length
984.0 nt
GC content
0.4980

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-340.20 kcal/mol
Thermodynamic ensemble
Free energy: -355.58 kcal/mol
Frequency: 0.0000
Diversity: 180.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((..(((((((((((.((((((((..(((...(((((.(((((((...((((((.((((((.((.((((..(((((((((((((((((((((.....((.(......).)).....)))))))...((((((....)))).))(((((((.....))))))).....)))))))))...)))))..)))).))))))))....(((((((((((((.(((....))).)))))))).........))))).....(((((((.....))))).)).((((((.((((((......))).).))....)))))).......(((((...))))).....((((.(((((((((((((((((((((..(((((.(.(((((...((((((((((((....)))).....(((((((.......)))))))..(((((....)))))((((..((.(((....))).))..)))).))))))))((((....))))(((((....))))).((((((....))))))...)))))...).)))))..)))........)))))).......))))))...)))))).))))))))))...)).))))))))))..)))..)))))))).)))))))....((((.(((((((((........((((......)))).((((........))))(((((((((............((.(((........))).))((.(((((.......))))).)).....((((((.....))))))....))))))))).....))))))).)).))))((((.......))))(((.....)))((.(((((.((((.((.(((((.....)))))..)).)))).)))))))((((((((((..((((((............)).))))))))))))))...(((........)))..............))))...))))))....
Thermodynamic Ensemble Prediction
.((((((..(((((((((((.((((((((..(((...(((({,((((({{...((((((.((((((.((.((((..(((((((((((((((((((((...,{((.(......}})).....))))))}...((((((....)))).))(((((((.....))))))).....)))))))),..})))))..)))).))))))))....{((((((((((((.(((....))).)))))))).........})))}.....,,,,{{{.....}}}}|{||.((((((.{{{(((......))).).))....)))))),}},..,|{{{,...})))}.....((((.((((((((((((((((((,{{.,(({{{.({(((((...((((((((((((....)))}....,|||||{{{,,..|,|}}}}||..(((((....}))))((({,,(({(((...,|}}.,,..}))).})))))))||||.,..))},{{{({....}))))|||,|||,.,})}}})},.,})))}...}}))})}..)))}}}}....)))))).......))))))...)))))).))))))))))...}}.))))))))))..)))..)))))))).)))))))....((((.(((((((((.,......((((......)))).((((........)))){{(((((((,{,,,.(((.{.((,(({..,,,,..}|}.})|.,{|}}},,,})))}.))))}),},,.((((((.....))))))....}}}}}}})).....))))))).)).)))).,{{.......}}(((((.....))))).(((((.((((.((.(((((.....)))))..)).)))).))))).{((((((((((..((((((........,,..)).))))))))))))))}..(((........}},..............))))...))))))....

Transcripts

ID Sequence Length GC content
ACUGCUUUCUUGGGAAGAUGGCGGCUGUGUCGGUGUAUGCUCCACCAGU… 984 nt 0.4980
Summary

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Expression of this catalytic subunit is downregulated by gamma interferon, and proteolytic processing is required to generate a mature subunit. A pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Jul 2012]

Forensic Context

A study in mice demonstrated that the PSMB7 was stable at 2 and 14 days post-injury but was downregulated at 60 days post-injury following controlled cortical impact, as part of a cluster of genes associated with apoptosis [Izzy et al. DOI:10.3389/fncel.2019.00307].