| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGCUUUCUUGGGAAGAUGGCGGCUGUGUCGGUGUAUGCUCCACCAGU… | 984 nt | 0.4980 |
The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. The encoded protein is a member of the proteasome B-type family, also known as the T1B family, and is a 20S core beta subunit in the proteasome. Expression of this catalytic subunit is downregulated by gamma interferon, and proteolytic processing is required to generate a mature subunit. A pseudogene of this gene is located on the long arm of chromosome 14. [provided by RefSeq, Jul 2012]
A study in mice demonstrated that the PSMB7 was stable at 2 and 14 days post-injury but was downregulated at 60 days post-injury following controlled cortical impact, as part of a cluster of genes associated with apoptosis [Izzy et al. DOI:10.3389/fncel.2019.00307].