| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGCCCCAGGCGGCGAGGAGAGCGGUGCCUUGCAGGGAUGCUGCGGGC… | 1017 nt | 0.5241 |
The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]
A study in mice demonstrated that the PSMB9 was upregulated during the recovery stage of non-lethal sepsis and was validated in human monocytes from patients with mild sepsis, where it effectively differentiated mild or recovering sepsis from severe sepsis [Zhang et al. DOI:10.1093/jimmun/vkaf140].