Basic Information

Symbol
PSMB9
RNA class
mRNA
Alias
Proteasome 20S Subunit Beta 9 RING12 PSMB6i Beta1i LMP2 Multicatalytic Endopeptidase Complex Chain 7 Really Interesting New Gene 12 Protein Large Multifunctional Peptidase 2 Proteasome Subunit Beta Type-9 Low Molecular Mass Protein 2 Proteasome Subunit Beta-1i Proteasome Subunit Beta 9 Proteasome Chain 7 Macropain Chain 7 EC 3.4.25.1 Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (Large Multifunctional Peptidase 2) Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 (Large Multifunctional Protease 2) Proteasome (Prosome, Macropain) Subunit, Beta Type, 9 Proteasome Catalytic Subunit 1i Proteasome Subunit Beta 6i Proteasome Subunit Beta1i Proteasome-Related Gene 2 Proteasome Subunit Β1i PRAAS3 PRAAS6
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002800.5
Sequence length
1017.0 nt
GC content
0.5241

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-357.30 kcal/mol
Thermodynamic ensemble
Free energy: -378.58 kcal/mol
Frequency: 0.0000
Diversity: 251.14
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((((.(((((......((((.((((.....))))))))(((((((((..((((((.....)))))).........(((((((((.(((((((((..(((((((.((.(((.(.((((((((((.(...(((((((.((.((.........((.((((.((((((..((((((((((((...(((.(..(....((((.....))))...)..))))))))))...))))))))))))..))))...)).((((((.....))))))...((((((..(((((((((((((.(....(((.((.((((....(((((((((((((((....))))..........)))))).)))))....))))..)).)))...)))))))))).))))))))))((((..(.....)..)))).)).))..))))))).....).))))))..)))).)))))).))))))))))))).)))(((((((((.........)))((((((.......)))))).((((((.(((.((((((.((((((....))))))....((((.((....))))))....((((((.....))))))..))))))...)))...))))))..........)))))))))))))))...((((....))))((((......))))...((((......))))..((((((((.((.(((((((((((((((((.((((..(((..(((((.......)))))...))).)))).)))))))).......))))).))))))..)))))))).))))))))))))))...((((((.(((..((((((((..(((.(((((............(((.....)))..........))))).)))..)))......)))))...))).).)))))((((......))))((((((....(((...................)))))))))(.((((((((((.....)))))))))).))))))..
Thermodynamic Ensemble Prediction
...,......(((((,(((((.,,,,,((({,((((.....))))|||}(((((((((..((((((.....)))))).,..,....((((((((({(({((((((..(((((((.((,(,{((.((((((((((.(...(((((((,,,.{(,..,,{,,,({.((((.((((((..((((((((((({..{(({.,.,|},..||||....,}|}||{,,...,))))))))...))))))))))))..))))...}},((((((,...,))))))...((((((..(((((((((((((.{...,(((,({.((((,...(((((((((((((((....}}}},........,)))))).)))))..,.))))..)).))),..,))))))))).))))))))))((((..(.....)..)))).)).,,.,))))))).....).))))))..)))).)))})).))))))))))))).)))(((((({{(.......,.}}}{{{||{,,.,.,,}}}}},.((((((.(((.((((({.((((((....))))))....((((.((....)))))){{..((((((,...,)))))).})))))).,.)))...))))))..........)))))))))))))))..||{({,,,,|}|}((((......))))...{{{{...,,,))})..((((((((.((.(((((((((((((((((.((((..{({..(((((.......)))))...)}}.)))).)))))))}.....,}))))).))))})..)))))))).))))))))))}))}...{((((,.{{{..(((((({(,,(({.(((((..,.........{((,....})),,........))))).})}..)))}.....}))))...}}}.,.)))))||{|.....{{|{{({{(,{..,,....}}}}}}.............,,})}}}}{.((((((((((.....)))))))))).))))))..

Transcripts

ID Sequence Length GC content
AGUGCCCCAGGCGGCGAGGAGAGCGGUGCCUUGCAGGGAUGCUGCGGGC… 1017 nt 0.5241
Summary

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]

Forensic Context

A study in mice demonstrated that the PSMB9 was upregulated during the recovery stage of non-lethal sepsis and was validated in human monocytes from patients with mild sepsis, where it effectively differentiated mild or recovering sepsis from severe sepsis [Zhang et al. DOI:10.1093/jimmun/vkaf140].