Basic Information

Symbol
PSMC5
RNA class
mRNA
Alias
Proteasome 26S Subunit, ATPase 5 P45/SUG TRIP1 SUG1 TBP10 SUG-1 RPT6 P45 S8 Proteasome (Prosome, Macropain) 26S Subunit, ATPase, 5 Thyroid Hormone Receptor-Interacting Protein 1 26S Proteasome AAA-ATPase Subunit RPT6 26S Proteasome Regulatory Subunit 8 Proteasome Subunit P45 26S Protease Regulatory Subunit 8 Testicular Tissue Protein Li 149 Proteasome 26S ATPase Subunit 5 Proteasome 26S Subunit ATPase 5 Tat-Binding Protein Homolog 10 Thyroid Receptor Interactor 1 MSUG1 Protein
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002805.6
Sequence length
1331.0 nt
GC content
0.5222

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-441.50 kcal/mol
Thermodynamic ensemble
Free energy: -469.06 kcal/mol
Frequency: 0.0000
Diversity: 445.15
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((((.(.((.(((.....))).)).).))..))))(((((.....)))))...((((...((((..((.(((((((.(.(.(((((((.((.((((...((.....))...)))).))......((((.....))))(((..((((((((((.(((((........((((((....(((((...((((((..(((...(((..((((((.........)))))))))..)))..((((((((....(((((.....)))))(((((((.(((((((((.(((.((..(((((..................)))))..))))).)))...(((....(((((.(((((.(((...........(.(((((...))))).)(((((.......)))))((((........))..))..)))))))))))))..))).))).)))))).)).))(((((((...)))))))..(((((((.........((((....((((((((((((.(((((((..(((((((((.((.....(((((......)))))(((((...(((...))).....))))).....((((((((((........)))).....)))))).((((((((....((((((.(((((..(((...)))..)))))))).)))....))))))))......(((((((((.(((((((..((((((((((...)))...)))..))))..))))))).)))))..)))))).)))))))))..)(((.(....).))))))))).)))))).))))))....))))..))))))))))))))))))))))))))..)))))).......))))).).((((...))))...)))))))))..))).))))))).)).)))))).).))..))))..))))..........((((((((...(((((....)))))(((((((.(...(((((((((..((.((.......(((.....((((..(((((((((.....)).))...)).)))..))))......))).(((((((..(((...((((...))))..)))...)))))))....(.(((.((....))))).))).))..)))).)))))..(((((((((((.(((...)))))))..)))))))........).)))))))..((((((((((.....)))))).)))))))))))).((((..(((((.(((((((.......)).)))))............((((...(((((.(((.......))).)).))))))).......))))).)))))))).
Thermodynamic Ensemble Prediction
((,,,,||((,{,.|||{{....((((.,....)))){{.{(((((.{{....)))},.}}|,}}{((((..{,.,{{||||.,.(,((((({{.(((((((...((,.{,,||{{.}}))})}....,,{{((.|||.||||(((,.({{(((((({,,((((...,..,.|{{(((....(((({,,.|{({{|.,||{|,,{{{..((((((.........))))))|||,{||,{{((((((((,,..(({((,,,,,|||}}})))))}..,|||(|({,{{{{(({((((((,((({,..,......{{{{(({{..(({{,.,|||,..{{,...{((({{(((((.(((..,.....,,{({{{{{|,,,)})})..(((((.......))))){{(,........,,.,})..))))))))))))}...(((((......))))).,{(((((((...})))))).,(((({,....,}}}}.{{{{{..{{{((((((((((.(((((({..(((((((((.((.....(((((......)))))(((((...,,,..,)),.,...))))).....((((((((((........)))),....}))))).((((((((....((((((.(((((..(((...)))..)))))))).)))....)))))))).,....(((((((((.(((((((..((((({{{((...}}}...}))}.})))..))))))).))))),.)))))).)))))))))..}(((.(....).))))))))).))))))}})))))..},,,}}..|||||},||||||||,|,,}}}),))}}))))})}},}..,}||||...((((...))))...))))|||||,.}},.,)))))).,.,|||}}}.},)).,},.|..,.})..})}}}}}.||||||||..,,{{{|...,)))))||{||||}{}}}|||||{|||,(((.,{{{{...........}}..,.}}}..|||||,,,..)).))||||||}|},,,||||,..,.,}},,|||{||,,|||},.{{{{...}})),.,}}..})})}}},....,.((({(({(..,,,..}))).))))}}|},}},}|{.(((((((((((.(((...))))))}.,))))))).},.....)})}}||||,{{(((((({(,..,,|||}}}}.||||,}}})))),}})}.,,|.((.(((((((.......)).))))).}}.........{|||,}}|||||,||{}}}..,})}),),})))))),.,..,}}))))))))))}})}.

Transcripts

ID Sequence Length GC content
AGAAGCGGAGUGAGUGAGGGAAGCGAUGGGCGCGGGAAUGGCCGGCCCA… 1450 nt 0.5269
GCUUCCGCGCUUGCGCGCCAAGACGGCUCGGAUGCCGGCGGUCUCUGCU… 1331 nt 0.5222
Summary

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]

Forensic Context

A study in mice demonstrated that the PSMC5 mRNA was down-regulated (0.35-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation [Dai et al. DOI:10.1080/09553000600857389].