| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAAGCGGAGUGAGUGAGGGAAGCGAUGGGCGCGGGAAUGGCCGGCCCA… | 1450 nt | 0.5269 | |
| GCUUCCGCGCUUGCGCGCCAAGACGGCUCGGAUGCCGGCGGUCUCUGCU… | 1331 nt | 0.5222 |
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been shown to interact with the thyroid hormone receptor and retinoid X receptor-alpha. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
A study in mice demonstrated that the PSMC5 mRNA was down-regulated (0.35-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body ionizing radiation [Dai et al. DOI:10.1080/09553000600857389].