| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAAAUAUCUACAGAAGAGCUGAAAGGAAGGUCAGCUUCUCAGAAGACAC… | 2635 nt | 0.5150 | |
| AAAAUAUCUACAGAAGAGCUGAAAGGAAGGUCAGCUUCUCAGAAGACAC… | 2624 nt | 0.5145 | |
| GCAGCGGGCCGGCAGUGGCGGCGGAGAUGGAGGAGGGAGGCCGGGACAA… | 2913 nt | 0.5294 |
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. In addition to participation in proteasome function, this subunit may also participate in the TNF signalling pathway since it interacts with the tumor necrosis factor type 1 receptor. A pseudogene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
A study in rats demonstrated that the PSMD2 was identified as a potential regulator of methamphetamine reward and addiction via transcriptome profiling of whisker follicles, showing down-down regulated expression (0.77 at MASA, 0.45 at WD) and a betweenness centrality score of 0.0236 [Song et al. DOI:10.1038/s41598-018-29772-1].