| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUGUUAGGCCGUCCCGGAGACCCGGUCGGGAGGGAGGAAGGUGGCAAG… | 1309 nt | 0.5332 | |
| GUUGUUAGGCCGUCCCGGAGACCCGGUCGGGAGGGAGGAAGGUGGCAAG… | 1319 nt | 0.5299 |
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the non-ATPase subunits of the 19S regulator lid. Pseudogenes have been identified on chromosomes 10 and 21. [provided by RefSeq, Jul 2008] CIViC Summary for PSMD4 Gene
No relevant information is available at the moment.