Basic Information

Symbol
PTGDS
RNA class
mRNA
Alias
Prostaglandin D2 Synthase L-PGDS PGDS Lipocalin-Type Prostaglandin D Synthase Prostaglandin D2 Synthase 21kDa (Brain) Glutathione-Independent PGD Synthase Prostaglandin-H2 D-Isomerase Beta-Trace Protein PGD2 Synthase Cerebrin-28 EC 5.3.99.2 PGDS2 PDS Testis Tissue Sperm-Binding Protein Li 63n Prostaglandin D2 Synthase (21kD, Brain) Lipocalin-Type Prostaglandin-D Synthase Glutathione-Independent PGD Synthetase Prostaglandin-D2 Synthase Prostaglandin D Synthase LPGDS PGD2
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_000954.6
Sequence length
812.0 nt
GC content
0.6342

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-326.00 kcal/mol
Thermodynamic ensemble
Free energy: -335.63 kcal/mol
Frequency: 0.0000
Diversity: 171.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.......))........................((((((....((((..((((.(((((...(((((((.((.((((...((((((.(((...)))))))))(((((.((((((((((((((.((....)).)).(((.((((.((((((....)))))))))).)))..)))))))))))).....(((((((((((((((..((((((..(((((..((((.....(((....)))..))))..).)))).)))))).))).))))..(((((((((((...)))))))))))(((((..(((...)))...)))))...))))))))...)))))............)))).)).)))))))..)))))))))...))))......(((.(((((((......((((((((.........(((((.(.((((.(((.....)).).)))).))))))..((((((..((((((((.......))))))))((((....((....))....))))))))))........((..(((.(((((..((..((((.(........).))))..))..))))).)))..))...(((((((....))))))))))))))).........(((((.((.((((((.((((((...(((((((((..(((((....))))))))))(((((.....))).))))))..))).)))...))))))......(((((........)))))...((....))......(((......)))....)).))))).....))))))).)))..)))))).
Thermodynamic Ensemble Prediction
(({,,,,.,||,,.......{{(.(((({...(((((((((({..{((({{((((.(((((...(((((((.((.{(((...,,{,((.(((,,,|}|},}|||(((,{.((((((((((((((.((....)).)).(((.(((,{((((((....)))))))))).)))..)))))))))))).,.}}||||{{{{(((((((..((((((..(((((..((((.....(((....)))..))))..),,))).)))))).))).))))..(((((((((((...)))))))))))(((((..(({...}))...))))),,{|,}})))}...)))))}}}.,,......)))}.)).)))))))..)))))))))...||||{{.........,|||||}......))))|,,......,,.,)))))))))))))))).))},|{|...,,}}},|,|,.((((({..((((((((.......))))))))((((....((....))....)))))))))),},,,.,,(,,,(,,.|||||,.||,.{{((,(........},||||..}}.,)))}}.|||,.},...(((((((....))))))),})))),..........||||{.({.((((((.((((((...(((((((((..(((((....}}}})))))).{(((.....))),))))))..))).)))...))))))......(((((........)))))...{{....||....,{(|,....,,))}.....,.)))}}......,,,,)),)))..,,,,,..

Transcripts

ID Sequence Length GC content
GCUCCUCCUGCACACCUCCCUCGCUCUCCCACACCACUGGCACCAGGCC… 812 nt 0.6342
Summary

The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the PTGDS as a novel diagnostic biomarker for sepsis with potential involvement in septic cardiomyopathy, demonstrating significantly lower expression in the peripheral blood of sepsis patients compared to healthy controls [Leng et al. DOI:10.2147/IDR.S554915]. A study in humans identified the PTGDS as a high-degree node in a protein-protein interaction network and found it was downregulated in the blood of myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580]. In a separate study in male mice, single-nucleus RNA sequencing of the ventral tegmental area showed the PTGDS was upregulated in both neurons and glia during the post-addiction phase of nicotine self-administration [Fan et al. DOI:10.1016/J.Jgg.2024.08.009].