| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCUCCUCCUGCACACCUCCCUCGCUCUCCCACACCACUGGCACCAGGCC… | 812 nt | 0.6342 |
The protein encoded by this gene is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of prostaglandin H2 (PGH2) to postaglandin D2 (PGD2). PGD2 functions as a neuromodulator as well as a trophic factor in the central nervous system. PGD2 is also involved in smooth muscle contraction/relaxation and is a potent inhibitor of platelet aggregation. This gene is preferentially expressed in brain. Studies with transgenic mice overexpressing this gene suggest that this gene may be also involved in the regulation of non-rapid eye movement sleep. [provided by RefSeq, Jul 2008]
A study in humans identified the PTGDS as a novel diagnostic biomarker for sepsis with potential involvement in septic cardiomyopathy, demonstrating significantly lower expression in the peripheral blood of sepsis patients compared to healthy controls [Leng et al. DOI:10.2147/IDR.S554915]. A study in humans identified the PTGDS as a high-degree node in a protein-protein interaction network and found it was downregulated in the blood of myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580]. In a separate study in male mice, single-nucleus RNA sequencing of the ventral tegmental area showed the PTGDS was upregulated in both neurons and glia during the post-addiction phase of nicotine self-administration [Fan et al. DOI:10.1016/J.Jgg.2024.08.009].