Basic Information

Symbol
PTGER2
RNA class
mRNA
Alias
Prostaglandin E Receptor 2 EP2 Prostaglandin E Receptor 2 (Subtype EP2), 53kDa Prostaglandin E Receptor 2 (Subtype EP2), 53kD Prostaglandin E2 Receptor EP2 Subtype PGE2 Receptor EP2 Subtype PGE Receptor EP2 Subtype Prostanoid EP2 Receptor COX-2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000956.4
Sequence length
2458.0 nt
GC content
0.4951

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-837.30 kcal/mol
Thermodynamic ensemble
Free energy: -881.11 kcal/mol
Frequency: 0.0000
Diversity: 766.70
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((((.(.((((((.(((((((((((.((...)).))))))((((....)))).(.((((((..((((((.((..((((....)))))).))))))..((((((((((....((((....))))...))))))))))((((((..(((((....)))))..))))))((((((((.((((.(((....)))))))))))))))................((((((((((((((((...))))...))).(((.(((((....))))).))).(((....)))...((((((.(((....)))..((((.((((.(((((........)))...((((((((((...))).))))))))).)))).)))).((((...)))))))))).)))))))))..(((((((((..(((((...........))))).)).))))))).((((((.(((........))).))))))..)))))).)....((((((.(((.((((.(((((....))))).))))))))))..)))...))))).)))).))).))))....))))).))))....(((((((......)))...))))...((((((((((((....(((((((((((((...(((.((((((...(((((.(((((.........(((((........)))))..))))).((((.((((((((((((..((((.((((((..(..((......))..)..)..)))))))))..)))))))))))).))))((((((((.((((....(((((......))))).((((.((.(((.......))).)).))))...((((.((.(((((((...((.((((((...((.(((......((.((........)))).....))).))..)))))).))..))))))).)).))))....)))).)))))))).((((((...)))))).)))))...)))))).((((((((.((((.(((((((.((((((............((.((.....)).))............)))))).))))..)))..............((((((((.(((...((((((((.(((((((.(((((((((((..........)))))....(((((((......))))))).....((((((..(.....)..)))))).(((((.((((((......((.(((((..(((((...((.(((((...(((..(((((((....((((.((((...((((...((((((((((((...(((((..((((((((...)))))))).)))))..................)))))))).((((((.......((((((((((.((....(((..(((((.........(((((....((((((.......))).)))......)))))..)))))..)))((((((....((((((.((..(((((((......))))))).((.((((.........)).)).)).)).)))))).....)))))))).))))))))))((((((.(((...))).)))))).....))))))........)))).))))....)))).)))))))))))..)))...)))))))...))))).))))).))((((((((....(((((........(((.(((((.....))))).)))....(((.((...(((((....(......)...)))))....)).))).((.(((((..((((..(((((.((((((((((((.....(((((((.....)))))))......(((((((..........))))))).....((((.(((((((....))).)))))))).....(((((....)))))((((...((((((.((((.......)))).))))))((....))..((((((......))).)))(((((.......)))))))))....))))..))))))))..)))))..))))..))))))).....)))))...)))))))).)))))).)))))....................)))))).))))..))).)))))))).....)))...))))))))(((((........)))))............((((((........))))))....))))))))))))..))).....))))))))))).))...((((((......((((((...((......))....))))))))))))....((((((((((....(((.((((((((.((((((((....))))))))..)))))))).)))........))))))))))...)))))).............))))))..(((((((((((((.(((((((.((............)).))))))).))).)))))))))).........................
Thermodynamic Ensemble Prediction
,(((((,((((({,(,,,,||..||||||||||({(({.{{{{||||||((((,,,,||||{||((((({,{{(({{{{{..,{|||||,,|,||||}}}}}))}}|{((((((((,,..((({...,||||,,|||||}}}|||(((({(,,(((({.,,,|||||,.}}}}}}(((((((,{((((.(((....))))))))))))))).,,,,,......,,(((((,(((,...}|||...})))).....{{({,.,||||.{{((({{(((,((,((,...((((((,.,,,..(((....))}.}|||}}..||}}}},},.)))}}})||,}}}||||||||||,.,}}.,}}}}}}||||||,..}}}}}}}}}}|(({(((({{{.{{{(((((({(((((((({{{{((((,.....}}}},.)),}}..,.((((((((((((((.(((........))).))))))........))))))))((((.(((.((((.(((((....))))).))))))))))).|||...}},)),,|,}.)))}}))}}}}}))))).}),)}}}}))}}||,..,,,{||}||||||||..((,((....||},...||||.||((((({{{(({...,,,,,{,.{{(((.|,,,..........,}}})),})}},,)))))))))))}}||||,((((((((((((..((((.(((((,..,..((......))..}..}..)))))))))..)))))))))))).}}}}{(((((((.((((....(((((......))))).((((.{(.(((.......))).)}.))))...((((.((.(((((((...((.((((((.,.((.(((......,(,{,........}},,.....))).)),.)))))).))..))))))).)).))))....)))).))))))))}||||||}}.}})))))))}}),}}))))))}||{(((({{({,({(((((((((((,((..........,,||.{{||......),}}.,,.}}}},}))))}}}))))},}}|{(((,.{,,,,{,.((({{{{{.|||..,{{{{{{{{.||||||{.,{{{|||||||}}|{{{{...,}}}},...(((((((......))))))).}},,||||||,,|||.,,|..||||{{{((,{({(((,(({..,{{((.,((((,.(((((.,{((,((((,{{{((({{((((((({...,,,,.,({{.{(((,....}}}},(((((((...(((((..((((((((...)))))))).)))))..................)))))))},,,.,||}}}}}..,,||||||||}|,}}}}}|,..||||({{....}},,,{{{....((((((.......))).))}......}}}},..,||||(({,,.,||||}}}.,{({{{.||,,||||||,.,}}},,))),))}}}}||}|.......,,|}.,,{||.,,}))},})}}...,))))),},))))},}},)}|||||},,{{,.{|,.,|||||{{{..,{{{|{...,{{{{.|||{|{..||,|||||,|}}||||}}}}..,||{{{||,,,.,.}}))))).))))),))|||{{{{({{{{((({(...{{...(((.(((((.....))))).))).}}.|||}||}},|{((({(({({...{{,...},)),..}}))})))}{{.(((((..((((..(((((.((((((((((((,....(((((((.....)))))))..,{{.(((((((..........))))))).,}}.{(((.(((((((....))).)))))))}{,.,{(((((....)))))||||...((((((.((((.......)))).))))))((,.,.|},.|||,||,.....}}}.,}|({{{{,......,})))},))...,))))..))))))))..)))))..))))..))))))}.}}}})),))},.,,))))},.)))}}}})))))}|...},},},,,,,..,,,,|}}}}.||||..,}}.)))))))),,,,.}}},,,|||||}}}(((((........)))))...,,,|},,,.((((((........)))))}...,}))},||||,}|........,...)))}||,{(((((((((((((......((((((...{{......))....))))))))))}}.})))))))}|}|.,,,,|||.((((((((.((((((((....))))))))..)))))))).}}}......,.,,,,,..,,{{{{,|(((....))))}}}}..,)))))..(((((((((((((.(((((((.((..,......,..)).))))))).))).)))))))))).........................

Transcripts

ID Sequence Length GC content
GCGGGUAGGCGCGGGAGCCUCGAGCGCCGCUCGGAUGCAGCAGCCGAGC… 2458 nt 0.4951
Summary

This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]

Forensic Context

A study in rats using single-cell transcriptomic analysis identified the PTGER2 as an orthologous gene associated with inflammatory processes in radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In human trauma patients, analysis of circulating leukocytes demonstrated that the PTGER2 transcript was significantly changed from control and its expression level was correlated with the Max Denver 2 clinical trauma score [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. A study in rats demonstrated that the PTGER2 gene (Ptgs2) was significantly upregulated (47.3-fold) in fluorescence-activated cell sorted CD11b/c+ microglia and macrophages from the striatum 2 hours after a binge methamphetamine regimen, indicating its role in the associated pro-inflammatory state and prostaglandin synthesis [Kays et al. DOI:10.3390/brainsci9120340]. In a separate study, the PTGER2 gene (PTGS2/COX-2) was significantly upregulated in both human (FC 12.1) and rat (FC 7.8) skin at the peak of hyperalgesia following ultraviolet-B-induced inflammation [Dawes et al. DOI:10.1371/journal.pone.0093338].