| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGGGUAGGCGCGGGAGCCUCGAGCGCCGCUCGGAUGCAGCAGCCGAGC… | 2458 nt | 0.4951 |
This gene encodes a receptor for prostaglandin E2, a metabolite of arachidonic acid which has different biologic activities in a wide range of tissues. Mutations in this gene are associated with aspirin-induced susceptibility to asthma. [provided by RefSeq, Oct 2009]
A study in rats using single-cell transcriptomic analysis identified the PTGER2 as an orthologous gene associated with inflammatory processes in radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In human trauma patients, analysis of circulating leukocytes demonstrated that the PTGER2 transcript was significantly changed from control and its expression level was correlated with the Max Denver 2 clinical trauma score [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. A study in rats demonstrated that the PTGER2 gene (Ptgs2) was significantly upregulated (47.3-fold) in fluorescence-activated cell sorted CD11b/c+ microglia and macrophages from the striatum 2 hours after a binge methamphetamine regimen, indicating its role in the associated pro-inflammatory state and prostaglandin synthesis [Kays et al. DOI:10.3390/brainsci9120340]. In a separate study, the PTGER2 gene (PTGS2/COX-2) was significantly upregulated in both human (FC 12.1) and rat (FC 7.8) skin at the peak of hyperalgesia following ultraviolet-B-induced inflammation [Dawes et al. DOI:10.1371/journal.pone.0093338].