Basic Information

Symbol
PTGER4
RNA class
mRNA
Alias
Prostaglandin E Receptor 4 EP4 Prostaglandin E Receptor 4 (Subtype EP4) Prostaglandin E2 Receptor EP4 Subtype PGE2 Receptor EP4 Subtype Prostanoid EP4 Receptor PGE Receptor, EP4 Subtype PGE Receptor EP4 Subtype PTGER2 EP4R
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_000958.3
Sequence length
3431.0 nt
GC content
0.4972

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1174.80 kcal/mol
Thermodynamic ensemble
Free energy: -1234.21 kcal/mol
Frequency: 0.0000
Diversity: 996.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((((...((((((((.((((((..(((((((((((((((.(((.........(((((((((((((((...))))))....(((((((...((((((((.....(((((((.(((((....(((((.((...........)).)))))....))))))).))))))))))((((((((((....(.(.(((....(((((.(((((.....)))))...)))))....))).).)))))))))))((((((((((.(((((..((...))...)))))..))))))).................)))((((((((...........))))).)))...(((.((.(((.((((((((((((....((((..((.((((((.(((.(((...(((((((................)))))))..((((((....)))))).))).))).)))))).))))))))))))))...))))..))).)).))).))))))))))......))).)))))).(((...)))))).)).))))))).((((.(((((((....(((((((((((((.....)))))))..((.(((((((.(.((....(((((((...(((((((((.............)))).)))))...((((....)))).((((((((((((((.(((((...))))).))))))))))(((((...(((((((((..((((((((((((.....)))).((((((((((((((((((((...........))).))).((((((((.((((((((..((.....))...)))))))).(((((.(.((((.(((.(.........))))..))))))))))))))))))((((((....))))))..)))).))))))))))............(((((((((((.....)))....)))).)))))))))))).)))))))))....)))))...........))))..))))))))).).)))))))))...((((..............)))).((.(((((......))))).))........)))))))))))))..))))....((((((.((....))))))))(((.((..(((....))).))))).(((....)))((.(((........))).)))))))).)))))).......)))))))).)))))))))).....(((((((((.(((((.(.(((..((((((.((.....)).))))))..))).).))))).))).)))))).(((((.(((((.((((..(((((((.......)))))))....)))).)))..((((((((((((.(((....)))...((((((...))))))(((((((((((((((((((((..(((...((((((((.............((((((.....)))))))).))))))))).....)))))))))))).(((..(((((.((((((..........(((((((((..................)))))))))((((((..((((...((((((((((.((((.((((.((....))))))..........(((((..........)))))...........((((((.........))))))(((.....)))))))..)))).))))))...))))..)).))))............(((((((.((((((((((((((((((((....((((((((.(((....))).))))))))....((((................)))).((.((..((((((........))))))....)).))(((((((((....))))))))))))).))))))))))).((((((((.((((((..........((((((.(((((.......))))).))))))..))))).).))))))))...))))).))))))))))))).))))).))))))))))))))))))))))))...(((((....))).))((((((.((((((((((((.(((((...)))))............((((((((((..((((((((((((((...(((((...((((.((((((((((...((((.((((((((((...........((((((((.((((((((((((..(((((......(((((..........))).))......))))))))))))))......(((......)))(((((....))))).((((((((((((((.(((((((.(((((............(((.(((((((((........)))))))))...)))..(((((..(((......)))..)))))..)))))..))))))))))))).....(((((((((((((...((((((((..(........)..))))))))....)))))))).............((((((....))))))))))).....)).))))))....)))...)))))))).......))))))))))...))))))))).......((((((((.((((.(((((.....((((((((...........))))))))....)))))..((((...((((.(((.......)))))))(((..((((((((((.((((((.........(((((.......)))))..........((((((.((((((((...)))))))).))))))...))))))..))))))))))..)))))))....)))).))))))))........(((((...))))))))))))))))))))))))))..(((((((((...))))))))).....)))))))...))).))))))).........))))..)))))))))))).)).........))))))).((((((.......(((((.(((((...(((((((((((((..((((.((.....(((((((((((((((((............)))))))...............))))))))))...((((((((((.(((((((.(((.....((.(((((((..(((....))))))))))))....((((((((........)))))))).....(((((((.((((......))))..)))))))(((((..(((....(((((((...)))))))(((.((((((.......(((..((((((((((..(((.((.((...)).)).)))..))))....))))))..))).....)))))).))).)))))))).))).))))))).))))).)))))....((((((.((((.....((((((......)))))))))).)))))).......)).))))..))))))).......))))))))))).........))))).......))))))..........
Thermodynamic Ensemble Prediction
.((((((((((...((((((((.((((((..(((((((((((((((.(((,..,..,..{((((((((((((((...)))))).{,{((({(((,..((((({{{..,,,((({{{(.(((((..,.(((({.,|,||........)}.)))))}},.)))))}},)))))))))}((((((((((....,.{{(({....(((((.(((((.....)))))...)))))....))),,.,)))))))))){{,(((((((.(((((..((...))...)))))..))))))).||..,,,.........{|,{{,......,}..,,..,,))))}|,||,,,(({.((.(((.((((((((((((....((((,.{(.((((((.(((.(((...((((((({(........}},...}))))))..((((((....)))))).))).))).)))))).}))))))))))))}..,))))..))).)).))).))}))))))),,....))).)))))).{{{,,,}}}))).)).))))))).{{((.((((({(....{((((((((((((.....)))))))|.({,{{(({|{|{,{{....((((({|...(((((({{{..,|.....,.,.}))||)))))...((((,...}||}..,,.((((((((((.(((((...))))).))))))))))|||||...{((((((({..({((((((({((....,||||{((((((((((((((,,,,||,,|....,|..}}}.}))}((((((((.((((((((..{,.,,,,|,...)))))))}.(((((,(.({{(,({(.(......,..||||,.}}))))))))))))))))(((({{....})))))..}}}}.)))))))))}...,,||.....,||||||{(({.....})),,.,))})})})))))))))).}))))))))....))))),......))))),,..,||||||,.|{|{,,||||}},....)))}..,}||,}},,,))}},.,,.{((((......))))),}}|,,....,)))))))))))))..)))),||,(((({{{((....)))))))){{{.{{..(((....))).})))},(((....)))|{.(((........))).)))))))).)))))).......,))))))).)))))))))).....(((((((((,(((((.(.(((..((((((.{(.....)}.))))))..))).}.))))}.))),,})))|,(((({.(((((.((((..(((((((.......)))))))....)))).)))..(((((((((((({(,({{{{{{||.|{(((((||.}}))))||..,,|||||||||||||||}.|||,..((((((((,............((((((.....))))))}|,}}}}}}|||{,,,.,|||}}|}}}}|||}}.,{{{{{.{(({({.......|,.{{(((((((||,,....},.||.....)))))))))||{|((..((((.,.((((((((((.((({.{{{{.{(....}}||||....,,,,..((({{........,,||}}}...,|,,....((((((.........))))))(((,...,)))))))..}))}|||}))}.|.))))..)).||}}.....||||...(((((((.((((((((((((((((((({...,((((((((.(((....))).))))))))....{.{{.....,,..,...,,,))|{{(......((((((........))))))...}))},,(((((((({....})))))))))))).))))))))))).((((((((.((((((..........((((((.(((((.......))))).))))))..))))).).))))))))...))))).))))))))))))).)))))))))),,})),)))))))))))))).|||{(((...,))).)}||||{{,{{((((({,{{{.(((((...)))))......,,||..{{((((({((..((((({{((((((({,,({{{{,.,||||,|(((((((({..,(({(.(((((((({{..,.,,,.,,,((((((((,((((((((((({,,(((((...,..(((((..........})).))..,,..))))))))))))))......{{(......}}}(((((....))))}.{{{(({|{((((((.(((((((.(((((.,.........,{({.(((((((((,,...}}.)))))))))...}}}.,(((((..(({......)))..)))))..)))))..))))))))))))),....,,,,,((((((((.,.((((((((,.(........)},))))))))...,))))))))...........{{((((((....)))))))),}}.....}|,)}}})),,..))).,,}))))))).,,,,{.}}||||||||,.,||||}}}||,,,{{{,(((((({({(((({,,,||}}}},{(({((((....,,...,,)))))}}}..|,|||||{,,,{{...(((,{(((.......)))))))|||..||{||{{{||.{||{|{.,.......{{{((,..,,|,|||||,,,{{,,,,,{(((({.((((((((...)))))))).}))))},..},|||||||}}}||||||,,|,.,,})}}..,}},.,}}}}})}..,,.,,.(((({...})))}))))},)))))))))))))))..(((((((((...))))))))).....}}}}}}}.,,|}}||}))})}.}},.....))}}..)))))))))))).),.........))))))),|{{{||||||,,,|,,,..{{(({...((({((((((((({.{{({.{,....,{{{{{||||||{{{{{{,,,,..,,...,)))),,)}}},,,,}}},))),)))}}},,,,...{(((((((((.(((((((.(((,,,,,{{.((({{{{,,|{{,...,,))))}}}}},....((((((((........)))))))).....(((((((.{(((......))))..))))))),{{({,,{{{....(((((((...)))))))(((.((((((.....,,(((,.((((((((((..(((.((.({...)).)).)))..))))....))))))..)))}})}))))))).))),)))))))}.})}.))))))).))))).))))}.|,}||{{{|.|{||,...,((((((......))))))}}}).)))))),.,.,,.,}.)))),}))}}))),..,,,,))))))))))}.......}}))))),.........,,,..........

Transcripts

ID Sequence Length GC content
ACAGAGGGUGGAAAGGCGAGAGCGGAGCUCCAAGCCCGGCAGCCCGAGA… 3431 nt 0.4972
Summary

The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the PTGER4 is an orthologous gene associated with inflammatory processes in a model of radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In human skin wound healing, the PTGER4 was identified as a marker for innate lymphoid cells (ILC) [Liu et al. DOI:10.1016/j.stem.2024.11.013]. A study in rats demonstrated that the PTGER4 was upregulated in CD11b/c+ microglia/macrophages from the striatum and prefrontal cortex at 2 hours following a binge methamphetamine regimen, suggesting its involvement in a prostaglandin E2-mediated autocrine feed-forward cycle that promotes inflammatory signaling [Kays et al. DOI:10.3390/brainsci9120340].