Basic Information

Symbol
PTGS2
RNA class
mRNA
Alias
Prostaglandin-Endoperoxide Synthase 2 COX2 Prostaglandin G/H Synthase 2 Prostaglandin-Endoperoxide Synthase 2 (Prostaglandin G/H Synthase And Cyclooxygenase) Prostaglandin H2 Synthase 2 Cyclooxygenase 2 PGH Synthase 2 EC 1.14.99.1 PGHS-2 PHS II COX-2 Cyclooxygenase 2b Cyclooxygenase-2 EC 1.14.99 GRIPGHS PGG/HS HCox-2 PHS-2
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_000963.4
Sequence length
4510.0 nt
GC content
0.3683

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1109.91 kcal/mol
Thermodynamic ensemble
Free energy: -1202.91 kcal/mol
Frequency: 0.0000
Diversity: 1056.41
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((.((.((.((((((...((((((.(((..(((....)))..)).).).)))))...))).))).)).)).)).....(((((((((((((((((.(((.((...((((((((.(((((.((((...))))..))).((((((((((.((((.......)))).))))...(((((((....)))))))(((((((((((.((..((....))...)))))).).)))))).(((.((.((((((......))))))..)).))).......(((((..(((((((((.(((((((........((.(((((....))))).))........))).........((((..(((((((.(((.......)))..........((((((.......(((((.(((((.((((((((........(((((((((.....(((((((((((.(((((...((((((((.........(((((.....((((.....))))((((((....(((((................)))))..))))))....(((((..((((.((((((.....)))))))))).)))))..((((((.((((....((......))....))))...))))))....(((.....)))..(((((.....)))))...(((((...)))))(((.....))).))))).....((((((.((((....)))).))).....))).((.(((((((........))))))).))....))))))))..))))).)).....))))...)))))...)))).)))))..))))...))))))))).............((((((((.((((.(((.(((.......))))))))))..........((((((.((((.(.....((((((...(((((..((((.(....)..))))..)))))))))))....).))))..))))))))))))))..(((.((((.....)))))))))))))))))).)))))))....)))).....(((((...))))).....)))).))))))))).)))))....)))))).......((((((......)))))).((..(((((.(....(((.(((...))).)))....).))))).)).......((((((.((...........(((((((((((((((((((.(((.....(((((.(((((((((((...........(((..((((........)))))))........))))))).)..))).)))))((((......)))).......................))).)).))))))).....))))))))))..........)))))))))).)))))))).))))).))))))..............((((((((((........((((((((((.(((((((..((((..((.........(((((.(((((...........((((((...))))))........))))).))))).((..((((((...((((....(((((((.(((((...((((....))))...))))).)))))))......))))...))))))..))....((....))))..))))..))))))).)).....(((((.....((((.......)))).....(((((.(((((......))))).))))).)))))...)))))))).....((((((((((....(((((.......(((((((((((((.....((((((........))).)))...((((((((....))))))))......)))))))..((.(((.((((....................................)))).))))).))))))......)))))....)))))))))).......((((((((((..((.(((((((....(((((((((((......((((((.(((...(((((.(((.((((....)))).))).)))))((((((((((((....))))).(((((((((((.(((....))).))))))))))).)))))))......((((((((((((((.((.............(((((((((((..(((...(((((.(((((((........))))))).)))))..((.((...(((((...((((((((..(((((....(((..............)))...))))))))))))).....)))))....)).))))).))))))))))))))))))))))))))).........((((.((((((((......)))))))).)))).......(((((((......((((((........)))))).......)))))))...)))))).))).........)))))))))))....))))))).))..))))....))).)))...............(((.(((((((....((((((..((((((((..(((((.........)))))....((..(((((((..((...))..)))))))..))...........(((((((.(.((((((((((.........))))).((((........)))).(((((((((...........))))))))).((((((((((.(((((((........((((((((...(((((((..(((.((((.(((((...........)))))..)))).))).......(((((((((.....(((((...(((((((((...)))))))))......((((((((...(((((((..............))))))).(((((.....)))))...))))))))......(((((.((((((((((........))))).)))))...)))))((((....)))).))))).......)))))))))((.(((((((((((((((.....))))))..)).))))))).)).((((((((.((..((.((((((((((((.......((((.((((.(((((..((((.((((((...((((((.......)))))).....(((((((.........(((((........))))).........))))))).(((((((((..((..(((((((((((((...((.......))..)).))))))((((((((((((((.(((((((((((((((......))))))))....((((((((.......................((((((.......))))))(((((((((.......)))))))))...........((((((((((((....))))..))))))))..........((((..(((....)))))))....))))))))....))))))).))))))..........)))))))).((((((...))))))....((.((((((..((((((((((((....))))))..((((.(((...))).))))..(((((....)))))((((((..(..((..(((..(((((((......)))))))..)))........))..)..))))))...........................)))))))))))).))........((((((.(((((((.(((((......((((((.(((((..(((((.(((((((.((..(((..........)))...)))))))))...)))))....(((....))).((((.(((((...)))))))))((((((((((..(((....(((((..........((..((((((.....(((....)))....))))))..))..)))))...)))..))))))))))...((((((.((((......)))).))))))...)))))...))))))(((((....)))))((((((((...))))))))...((((......))))))))))))))))))))))...)))))..))..))))))))).((((((((....))))))))...))))))))))..))))).)))).)))).........))))))))))))))..))))))))))(((..(.(((((.....))))).)..)))(((....))).))))))).............)))))))).......)))))))))))))))))..(((((........)))))..........))))).)..)))))))..........))))))))..)))))).....((((((((((((.((((((.((.....)).)).)))).)))))))))))).............((((((((...))))..))))(((..(((.(((((((....))))))).)))..)))..))))))).)))..((((((....(((.((((((((((.......)))))).)))).)))..))))))....))))))))))........(((..((((.....))))..)))...))))).)))))).....
Thermodynamic Ensemble Prediction
..,,(({...,|,{{.((.((((((,,,((((((.(((..(((....))}..||.|.}|,)))}...))},|}},||.}}.}|.,,.,(({{{((...((........|}{{{{|({.|,|{..||{||.|{{,.,,)})}..))),..,)),)),).)))})}),,||||,,,,.))}}.(((((((....)))))))..........,,,........(((((((((((((((((((((((({.((.((((((......))))))..)).}}))))))))}((((..(((((((((.(((((({....,,..,.,{({,,....,}}))})}.....,.,|||......{{{(((,,.(((((((.{((...,,..}}}.....,,...((((((.....,.{({(,.(((((.((((,((......,{{(({((((((.....(((((((((,,.(((((...((((((((.........,((({.....((((.....}}}}((((((....(((((................)))))..)))))}....(((((..((({,((((((.....)))))))))).)))))..{(((((.((((.,{,((....,.))}}..))))...)))))}....{{||,...}}}..(((((.....)))))..{(((({...})))}|{,.....}}}.))))}.....{{{(((.((({....}))).))).....)}).((.(((((((........))))))).)).,,.))))))))..))))).,,.....))))...)))))...}})}|)))}},})}})}.,)))}))))).)),,...,,...,(((({,,..{||||((({.{.....}))||||.||||||.,,,....((((((.((((.(.....((((((...(((((..((((.{....}..))))..)))))))))))....}.))))..))))))))))}}}}.{(({.{{{|...,,))))))})}}}.)))))).)))))))...}))))}....(((({...}))))...},)))).))))))))).))))|,,((((((((((..{,{((((((......)))))).((((((..(((((((.,,.(({...}}},{(((((,...,)))}}}}}.,{{....,,,...}}}...,,.)))))))...)))))).((((((.......)))))).((((((.(((({......((((((((((((.{((....(((({({......}}}..((((((.((((.,(((.,,,,......|||,.................)))}.))))..)))))).,,...(((((((((((,...,))}.,,}))))))))..))))))).))))))))))))((((((({.....,..((((.....))}}....((((((({{(.(((((((..((((..((.........(((((.(((((......,....((((({...})))))....}}..))))).))))).((..((((((...((((.{,,(((((((.(((((...((((....))))...))))).))))))).,.,}.))))...))))))..))....((....))))..))))..))))))).)}.....(((((..,..(((({{{{{{.,|{|,....||||,.,||||......,},,,,))))).)}))),,.)))))))).....,(((((((((....(((((.,,....(((((((((((((.....{{{(((........))).}}}...((((((((....))))))))......)))))))..{{.{((.((((.......,,,...,........}}...}}}......)))).)))}}.))))))...,,.)))))....)))))))))))))))))((((((((((..({.(((((((....(((((((((((......((((((.(((...(((((.(((.((((....)))).))).))))}((((((({((((....))))},{((((((((((.(((....))).))))))))))).)))))))...,,.((((((((((((((.((,,..,,,,.....{((((((((((.,({(...(((((.(((((((........))))))).)))))..||.||...{||||.,||||(((({,{(((((....{({..{((({...})))),,.,,))))))))))|||,||..}}))),,,.}}.}}}}}.)))))))}}})}}))))))))))))))..}}.,,||{{({.((((((((......)))))))).))||||,{,,,{((((((......{{{{{{{,.,,))}))))))...|,..)))}))}...)))))).))).........)))))))))))....))))))).))..))))....))).)))......})))).)))))).,{{,.,,,....|||...,,,,....}},||{(({,......,))))),..)))))))))).,.,.,............)))))))))))))))...,,,,,|}}}|||,||,,,,..,,,,{{{{{{{,.{{{{...,}}}})}||.(((((((((.(({....)),))))))))).{(((((((((.(((((((........((((((((,,.,,(((((,,(((.{({{.{{{{{...........}}}}}..))))||||..,}||}((((((((({((((({,,{{{{({.,,|}|},}})))))).........((((((((...(((((((...,..........))))))).(((((.....)))))...))))))))..{(((.((,({(((,,{((,,.,{{{{{{||,}|,||},,...}}))))}}|}}}..,}}})))).}}.})))))))))))}((.((((((((({{{(({,....}})))}..)),})))))).)).((((((({,((..((.(((((((((((({.,,...((((.((((.(((((..((({.((((((,,.((((((.......)))))).,,,,{,,{,,,.........(((((........))))}.........||||||..(((((((((..((,.((((((.(((.((((((((({..(((.,,{{.....))}.))))))))...........(((((((((......))))))))).(((((.(((((..........{{(({...,{{({,,,(((((.{(((((((.,((((((((.......))))))))|(((...{{({{((((((((((((....})))..))))))),..,,......|||{..(((....)))}}||{{{.,,,.,.,,...,})))))}....)))}..)))))))).)))))..((((((...)))))).,}}}}})))}}........(((((((....))))))).((((.(({...))).))))..(((((....))))).))))).)))))..{(((..(((((((......))))))).,))).........))))))))...,,,,,,...............||,....|||||||,...,,|,........((((((.(((((((.(((({,.....{{{{{{.{(((,..{{{{{,{((((({.,{{,{.,.,,,..,..,}}},,.}}}}})}}},..,||||{,...|})}}}....((((.(((((...))))))))){{(((((({{{{{{{,,..,,{{{,{,{{{{{{{((,,{{{,((({((((((,,,,|......,,......,)},}}),.,})))))))))))))))},..{(((((.((((......)))).)))))),,,})||},,.}}}}}|{,{{,.,,.||,,,((((((((...)))))))),..{{{{......}}}))))))))))))))))))),.)))))),.))..))))))))).,,,.,|||,,,,}})))))),..))))))))))..))))).)))).))))...}}....})))))))))))))..)))))))))).||}}|}}||||||.,,,,,|{{{{....,}}}}}.,}},}},}}}},,}},,.......)))))))).......))))))))))))))))}..(((((........)))))..,|}},..,}}|||,}..}}}}}}}{{.,{{|,{,||,,}})}}}},,,}}}}}..||,((((((((({(({{{{.,{,,....,|||,}},|,|,,||||||||....,}}}}}}).}}|{{((({.....((((((,{{((..(((.((((({,....,)))))).)))..))),..,..)))))).....})))}}}}}}}.|,,,((((((.,.....)))))),||{{{{.....(((((((.(((((((.......))))))).))))))).,}}}}}},}},,...,,))))))))))))...

Transcripts

ID Sequence Length GC content
AAUUGUCAUACGACUUGCAGUGAGCGUCAGGAGCACGUCCAGGAACUCC… 4510 nt 0.3683
Summary

Prostaglandin-endoperoxide synthase (PTGS), also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. This gene encodes the inducible isozyme. It is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. [provided by RefSeq, Feb 2009] CIViC Summary for PTGS2 Gene

Forensic Context

A study in mice demonstrated that the PTGS2 is a key enzyme in prostanoid synthesis and pain mediation, showing significant upregulation in skin following ultraviolet-B-induced inflammation, with a fold change of 7.8 in rats and 12.1 in humans [Dawes et al. DOI:10.1371/journal.pone.0093338]. In human burn injury models, the PTGS2 was also significantly upregulated as part of the inflammatory and immune response during wound healing [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A study in rabbits demonstrated that the mRNA expression of the PTGS2 increased significantly at 1 hour post-incision, peaked at 3 hours, and was almost normalized by 3 days, with no significant increase observed in postmortem wounds [Bai et al. DOI:10.1016/j.forsciint.2007.07.006]. These time-dependent expression patterns support its application, in combination with other markers, for early wound age estimation and for distinguishing supravital injuries from postmortem damage.