| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCCCCACUGGCUGCUCUGAAAAGCCAUCUUUGCAUUGUUCCUCAUCCGC… | 1218 nt | 0.4565 | |
| CCCCCACUGGCUGCUCUGAAAAGCCAUCUUUGCAUUGUUCCUCAUCCGC… | 1215 nt | 0.4560 |
Enables DNA-binding transcription factor binding activity and histone binding activity. Involved in negative regulation of apoptotic process. Located in cytosol and nucleoplasm. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that the PTMA gene, a marker of proliferative phenotype, was upregulated in the neutrophil-like monocyte cluster (C9) that emerged following clodronate liposome pre-treatment and controlled cortical impact brain injury [Erwin K. Gudenschwager Basso et al. DOI:10.1186/s12974-024-03032-8]. This specific monocyte subset, characterized by this and other proliferative markers, was part of a broader immunoregulatory and neuroprotective response that reduced lesion volume, stabilized the blood-brain barrier, and improved cerebral blood flow when adoptively transferred into injured recipient mice. A study in humans identified ENST00000409321.5 as a down-regulated mRNA in peripheral blood mononuclear cells of ST-elevation myocardial infarction patients compared to non-ST-elevation myocardial infarction patients, with a fold change of 16.17, and it was classified as a diagnostic biomarker for acute myocardial infarction [Zhong et al. DOI:10.1097/MD.0000000000013066].