| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCCAACUUUUUCUCGGCGGAGUGAGCGCAGCGGGCGCAGACUCGGG… | 13360 nt | 0.4641 |
The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
No relevant information is available at the moment.