Basic Information

Symbol
PTPRC
RNA class
mRNA
Alias
Protein Tyrosine Phosphatase Receptor Type C T200 GP180 CD45R B220 CD45 LCA LY5 Receptor-Type Tyrosine-Protein Phosphatase C Glycoprotein 180 CD45 Antigen L-CA Protein Tyrosine Phosphatase, Receptor Type, C Polypeptide T200 Leukocyte Common Antigen Leukocyte-Common Antigen Leukocyte Common Antigen T200 Glycoprotein EC 3.1.3.48 IMD105
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Wound age identification Other applications

MANE select

Transcript ID
NM_002838.5
Sequence length
5357.0 nt
GC content
0.3825

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1326.1 kcal/mol
Thermodynamic ensemble
Free energy: -1427.42 kcal/mol
Frequency: 0.0000
Diversity: 1702.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((((.(((((((...((((((((((.(.((((((......((((..((((.((((((....)))))).))))...........((((.((((((..((..((((((((((.((((((...((((.....((((((......))))))((((....(((.((.((((((((((((((((...(((..((((((....)))))).))))))))))))........(((......))).............))))))).)).)))))))((((((((((............)))).....(((..........))).......))))))(((((......)))))(((((........))))).(((((.....((((((......))))))....))))).((((((...(((..((((............((((((((.........))))))))...........)))))))...)).)))).....(((((((.......)).)))))((((..(((((...))))).))))....................((((....))))...)))).))))))..)))))......)))))..)).))))))))))..))))(((((((.((((.......(((.(((((((((((.....((((...)))).......))))(((.....................)))......(((((.((..........)).)))))............((((..((((((..(((((((..((........))..)))))((((..(((((((.(((...((((((((((......(((((..(((.((((((((..........................))))))))...(((.....))).((((((.(((((((((((.((.......)).))))......(((((.....)))))(((((.((((....))))))))))))))))))))))...((((((((((((((((.....(((((.......))))).....))))))...........))).))))))).(((((((((((........(((......((((((.....)))))).......)))........))))))).))))....((((((((.(((........))))))))))).(((((((((...............((((.((((.(((...........((((((...((.....))...))))))...........))))))).)))).....((((((((((.(((...((((((((((.((((((.........((((((((((((.....(((......)))..)))))))))))).)))))).)))).....)))))).))).))))))))))..((((((..........))))))...((((((...))))))((.......))..))))))))))))))))).....((((((..(((.....))).))))))))))))))))((.....(.(((((....))))).)....))..(((((((((((((((((..............(((((..(((.(((.(((((((....(((.((((.....)))))))((((..........))))..((((((((......(((.((.....))))).........(((((((((((((((((((....(((....(((..(((.(...((((((((.......))))))))...).))).)))..)))....))))))..(((((.(((((....(((((((((....(((((((..((((((.((.((((((..................((((....(((((.(((.((..(((((....(((((((((((((....((..(.((((((((((((((....((((((((..........(((((..........)))))........)))).)))))))))).)).))))))..((((((...............((((.....((((..((((.(((((...)))))))))........((((((((.((.((.....)).))..))))))))))))....))))...))))))....(((((((((.((((((((....))))))))(((((((((.......(((((...(((......)))...)))))...(((((......(((.(((.....((((((.......)))))).))).))).......))))).((((..((.(((((((((...........((((...........(((((((...((((((........))).(((((((..(((..((....((((....))))...)).)))..)))))))...((((.....))))...........))).....)))))))....)))))))))))))..))..))))...)))))))))..(((.((......)).))).((((((((........(((((.(((((...((((.....))))...)))))..................)))))...(((....))).....((((.(((((..(((...(((((((((((((.(((((....((((((.((.((((...)))).))..))))))....))))))))....)))).)))))))))...))))).))))..)))))))))))))))))...)..))....))))))...))))))))))))..))))))))))...)))).....((((((((.....(((.(((((((.......)))))))..)))(((((((((.(((((.....((...))....))))).)))))))))..((((........))))(((((((.(((((....))..))).))))))).)))))))).(((.(((...))).))))))))).))...)))).))...)))))))..((((((((..((((((....(((((......)))))))))))....))))..(((((((.((.........................)).)))))))(((((.....)))))..(((((((((.(((((((....)))).))).(((((((..((((.(((.....(((((....)))))((((..(((((...((..((((((((((...........((((((((..(((((((...........(((...((((((((((...)))))..)))))..))).)))))))...)))))))).(((((((..(((..((((...))))...))).(((((.(((((....((((.((.(((((.((((((((((((.....(((....)))..))))............((((.((((((((......(((((((.(((.......)))........))))))).....)))))))).))))..(((..((((((((((((......))))...((((.....))))..............))))))))....))).(((((..........)))))....)))))))).))))).))))))))))).)))))..)))))))..))))))))))....))...)))))..))))..))))))))))))))...(((.((((....)))).))).((((((...)))))))))))))))...))))..))))))).))......)))))))))).......)))))))))))))..)).))))))....))))))).))).)))...........)))))..............)))))).))))).)))))).......))).)).)))))..)))).............((((((..(((...)))...)))))).((.(((((((........((((.(((....))).))))..))))))).)))).))))))..))))(((.......)))...))))))).)))..((((((...((((((.(((..(((((((..(((...)))...)))))))...)))))).)))........))))))..............)))).))))))).)))))).).))))))))))(((((((((....)))))))))........(((((....(((((.(((.(((((..((((((.(((((.......((((((........)))))).(((((((((((.((((...)))).)))).))...))))).((((.(((((((((............((((((..........))))))((((((((.((((((.(((((....(((((((((....(((...(((((.((((((((((..(((((((((..............((((((((((......((((((....)))))).((((((....)))))).......(((((((......))))))).......)))))))))))))))))))......))))))).....))).))))))))....)))))))))......)))))...((((........))))...(((.((((((((.(((((((.(((.((..((((((((.......)))))))))))))))))))))))))))).)))......)))))).))))))))..........((((((((((((((.((((.....)))).)).))))..)))))))).....((((((((((.((((....))))...)))))))))).))))).)))).))))...))))).).....)))))....))))).))))))))...)))))....((((((((((.((.....(((((.....((((((((.........)))))))).....))))).............((((((((((((((((..(((((((((...........(((((......)))))..........)))).)))))..)))))))..((((....)))).(((((((((....)))))))))...)))))))))..((((.......))))......((((((........((((.(((((((................)))))))..))))..........))))))(((........)))...........((((((((((((...(((..((((((((...))))))))....)))...(((((.((((.((((....((((...((((.....))))...))))....))))..))))))))).......(((((((...........)))))))........................)))))))))))).......)).)))))))))))))).)))..))))).
Thermodynamic Ensemble Prediction
.......(((((.((({(({...{{{{|||(({,(((((,((,....,((((..((((.((((((....}))))).))))....,....{(((((.(,{{((,.((,.((((({(({..,|||.}}}}|||.,.,||{{{{,{{.,,,{|},},}}|||,,..,{,.{{.(({{(({(((((((((...(((..((((((....)))))).)))))))))))).....,,.|,|..,,||)},.,|......{{,.,}})))).)),)}},|||{....}|||,....,........}}.,)))))||..,.,.....|||{|,,...}}}...(((((......)))))(((((........))))).(((((.{...((((((......))))))..,.)))))..,{{||.,,|||,,{{{{.........,..((((((((.........}))))))}...........|||,{{{,,.,,(({{{.}|..|}}}|{||,,|||.,..{|,|{((({,.(((((...))))).,|||{{,,,...,,,{{{,....{(((({{,.||}|...,,,}.}|||}}|||||||,||.{{.,,},..}).}))))))),,.|}},,,{{{,,,.,{{{|{{,.,.,.,.,,{{{.,{(({,,,..,,||,,{|||},{{{,,{,(((((({{{{...{{{{,..{,{{((({{{{.....(((((.((.,........)).))))).....,,,.,,{{((((({{{{||,{((((((,{{{{,.,{((((,,,,{{{{{{{{{.,(((({{{.(((,..((((((((((,{{{{{((({{..,{,,{((({{.({,.((((({{{(((((.........,{{{{,.{{{...}}},,,}}||.((((({,(((((((((((.((.......)).))))......(((((.....)))))|((({,((((....))))))))})))))))))))))...((((((((((((((((.....(((((.......))))).....))))))}.,........))),})))))).(((((((((((.{{,.{{{((((((...,|||||}}}}.,|||||.....},})......}},))))))).))))....((((((((.(((........)))))))))))..,{{{{{,{.........}}}},.|(((.{((||(((...........((((((...((.....))...))))))...........))))))).))),.....((((((((((.(((...((((((((((.((((((.,.......((((((((((((.....(((......)))..)))))))))))).)))))).)))).....)))))).))).))))))))))}}|,||||}}}}}}..,.,}))},...((((((...)))))){(.......}}.,|||,...,))))))))}.....,,,,,,..,,,.....,})}))))),))))))))))...,,..{.(((({....})))}.,...,||..(((({{{{{(((({{{{............,,(((((,,(((.(((,({(((({.,{{,,..|{{{{{{,((((((((.,,....,,.)).))))),.(((((((({{....(((.(({...|)),))},.,,....{{{{{{{{((((,(((((({,{{((.....|||,,|{{.{...((((((((.......))))))))...}.}},.}}}..})),,..})))}}..{{{{{.{{{{,.,},|||||{{{{....|||||||..((((({.{{.((((((.{((({,{{,.,{{{,{{({((,,,,(({((((({.{(,.((((({..,{(({{{((((({(,{,,,{....((((((((((((({...{((((((((...,...,,.(((((..........))))).,,...,,)))).)))))))))).))},)))))..{{{|||||,.....{{{{.,{{{..{(((((,,,..||||,|||,,,..}}}))))},........,(((((((,(({(({,.,.||,||..}})))))}|||,{{.{||||{.((((((|{.((|({,(({({.{(((((((....)))))|||{|{,,||||,,,..,|||||,.....|.,..}})))}.|},},,.}}|||{|}},,},|{{,|||,,,,.((((((.......)))))).}}),))}.......}},,,.{({{{{{,.({(({,((({{{,...,,,.|||,..,,,,...,}|||||{{..}|{{|{|},.},,..}}},{((((((..({{,.{(.{..((((....))}}...)).))),,))))))}.,,|{{{.,,.,)))).,,.}}...},)))....})))}))),...))))),}}},,))).}),))))},).}))))||||||,{{|||||||,......,.,|||||}......||,|}},,.{((((...((((,...,))))...))))}..............,.(((((((.{.(((....))).}.))))))),....))))).,,,{||,|||||||}}|||||.,,.((((({.((,(((,...,}}).})}}))))))..,}),))))))}}}})))).))})))||,,||||||,,,,||}}|||||{{{{{|,||||},}|}{,},.,{{||}|||{,,|||||||||||}..}|||||||}|{{{|,||{{,..,,,,,|)}}}.}}}}|.(((((((.......)))))))..,,.(((((((((.(((((.....,,...,}.,..))))).))))))))),|{(((({{.....|||({((((((.{{,{{,,..}}..})).))))}}},.,||||||.{{{.{{,...})),))},}}|||,||,,,||||,||,,.}|||}}}..,|||{{((..((((((....{((((......))))})))))}....)))),{(((((((.((......................,..)).)))))))||(((,,...}}}}}..,..,|||||.({{((({....}))).))}.(((((((..{(((.(((.....(((((....)))))((((..(((((...((..((((((((({....,,.....{{((({{(,.((((({,...........(((...(((({{(((,...,}}}),,)))))..}}}.}}}})}}...)))))))|{(((((((.(((...})).))}},,..,}))).{((((.(((((....((((.({.(((((.((((((((,({((...,|||({(((,((,({((,..{{(((....,,...,{{({{{{,,,{{{((((({..{((.......)})...,..)))))),}}....}))))|||||||,,.,,})))||||(((,{(((......))))....,{{,...})))),}...,{{{{....,}},))))|||}}}..|||||},.,..,,...))......)))))))).))))).})))))))))).)))))..}}}},,}..})))))))))....))...)))))..))))..)))))))))))))),,}|||.||||}},,}))),|||,{{{|{{...,|}}|)}|)))))},.,,||||,.}}))))).))...,..)))))))}))}}},.,,)))))))))))},..}},))))})....))))))).))),))),..........))}}}..,,,,,,,,,.,,)))}}},)}}))))))))),......))),))),)))}..}}}}.............,{{{{,..|||...,|{{{{{{{{{{..((((((((((.......,{(({(,,{{{.,||.||,...,||}}||||,,,.,))}}}.,)},.|||}..{{..|||,.{|{||.|{{.((((((..(((.{,{({...}})}.)))..)))))}.,}}.)))..)),))))})..))))},)))}}.}}}}})))))|,,{|,............{{(,,..})},..,}}}}|}}||,|||,{(((((((((....)))))))))).,}}).,,{||||||{{{{,||||{,{,,,,.}}}||||||,,......,}}||||||,}}},...||||||,,{{{{(({{(({({({...|||||}}}}.}}},.,}}}},|||{,|,|||||||}}}}}}}},,}}}}}}|}}},,,....}}}},,..{{{{,,,.,||}}..,}}}|.}}}}}},..|}},.})}))},..)))))})))),||||}}||||||||||..{(({(.({{..((((((((((......{(((((....)))))}.((((((....)))))).......(((((((......)))))))....,,.))))))))))))).)))))......,,,...,.|||||||||,,........,}.)))))}}.,.,,,.,,}}...{{{{..,,....}}}}...(((.((((((((,({(((((.{{(.{,.{((((((((.......)))))))))})))))))))))))))))).))).,,...,,,,,...}))}}}}|,........{((((((((({{{{.{(((.....)))).)).)))}..)))))))}.....((((((((((.((({....})))...)))))))))).,,})))))))..,,||||}}}}.....|}}}))}),,..||,.,.}},,|||{{{{{{{{{,..,{{{{{({,{{,{.....,{((({...,.{(((((((.,,......)))))))}.....))))}......,.,,,,.{{(((((((((,{{,,{{{{{,((.(({,,,,|||,,,|||||..,|||}}}}}}},...}}}}}},,,|||||{||||||||,,{{||,,.||||.|(((((((((....))))))))}...,,}})})))},}})}}))),,,)))}}}}}}.{{((((.,......((((.(((((((......,.........)))))))..)))).........,))))))}||},||...,|||...,,{{,...(((((((((((({{{{,{,,({{{((((,,.}}}|||||{...,,.,,,})}||.||||,|{{{,,,.,{((,{.,(((,...,|||,.,.,,,,.,..)))),}))),,})},.}}}...{{{{{{{......,,...}}}}}))..,.,}},..}}}},,........,}))))))))))}}}}}..}}})}}}.,,,..,})).))}..))))).

Transcripts

ID Sequence Length GC content
GACAUCAUCACCUAGCAGUUCAUGCAGCUAGCAAGUGGUUUGUUCUUAG… 1395 nt 0.4108
GACAUCAUCACCUAGCAGUUCAUGCAGCUAGCAAGUGGUUUGUUCUUAG… 5357 nt 0.3825
GACAUCAUCACCUAGCAGUUCAUGCAGCUAGCAAGUGGUUUGUUCUUAG… 4874 nt 0.3683
Summary

The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]

Forensic Context

A study in humans demonstrated that the PTPRC mRNA was identified as a candidate marker for nasal mucosa detection via RNA sequencing [Chirnside et al. DOI:10.1016/j.fsigen.2020.102317]; however, specificity testing revealed it showed the strongest cross-reactions in all tested non-nasal body fluids except saliva, leading to its exclusion as a candidate for forensic body fluid identification [Chirnside et al. DOI:10.1016/j.fsigen.2020.102317]. In a separate study of human and rat corpus cavernosum, the PTPRC was identified as part of immune-related interactions and showed similar or higher overall information flow in human tissue compared with rat [Yin et al. DOI:10.1016/j.celrep.2024.114760]. A systematic review of human skin wounds compiled from forensic autopsies identified the PTPRC as a proteomic marker for fibrocytes, specifically noting that the appearance of fibrocytes (CD45+/Collagen I+) in wounds indicates an age of at least 4 days, with more than 15 fibrocytes suggesting a wound age of 9–14 days [Ros et al. DOI:10.3389/fmed.2021.786798].