Basic Information

Symbol
PTX3
RNA class
mRNA
Alias
Pentraxin 3 TSG-14 Tumor Necrosis Factor-Inducible Gene 14 Protein TNFAIP5 Tumor Necrosis Factor Alpha-Induced Protein 5 Pentraxin-Related Protein PTX3 TNF Alpha-Induced Protein 5 Long Pentraxin 3 Pentraxin-Related Gene, Rapidly Induced By IL-1 Beta Pentaxin-Related Gene, Rapidly Induced By IL-1 Beta Tumor Necrosis Factor, Alpha-Induced Protein 5 Tumor Necrosis Factor-Inducible Protein TSG-14 Pentaxin-Related Protein PTX3 Pentraxin 3, Long TSG14
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_002852.4
Sequence length
1884.0 nt
GC content
0.4745

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-639.60 kcal/mol
Thermodynamic ensemble
Free energy: -674.37 kcal/mol
Frequency: 0.0000
Diversity: 367.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((....((((.((((((((.....((((......)))).(((((((((.((((.((((.(((........))).)))).....(((......)))..........((((((((((.(((((((((((((.(((((...(((.(((..((((....))))))).))).))))).))))...............(((((......(((((((((((..((((((.((((....)))).))))..))..))))....).))))))......))))).))).)))))).))))))))))..((((.((..(((..((((...)))).....)))..)).)))).)))))))))))))(((((((((((((.(((..((((((((....(((((((((((((.(((((...(((((..(.((....)).)..)))))...))))).))((..(((.(((((...))))).)))..)).)))))))))))((((((((....))).((((((.(......).)))))))))))(((((((.((((..((...))..))))..)))).)))..(((((((...)))))))))))))))..)))))))))))..))))).((((((...))))))....(((((((.((((.((((((((....))))))))))))(((.(((((((((((((......))).)))))...((...(((((((((((....))).))))))))....))..........(((((((((....(((.....(((.((.....))..)))(((((.....))))).(((..(((((.....)))))))))))...))))))))).))))).)))(((((((.(((((((((.((((((((...((((((((((((((.(((.............)))(((((((....))))))).....((((.(((..(((((...((....)).))))).))).)))).......(((.((((....)))).)))...(((((.........)))))))))))))))))).)....(((((...))))))))))))).))))))).))..)))))))....((((((......))))))....................((((((..((((....))))..).))))))))))))...))))))))))))....)))).((((......))))((((((......(((((((((...)))))))))....(((.......))).....................((((((((((.((((.(((((.((..(((..(.(((..(((............))))))..)..)))..)).)))))..))))........(((((((((.((.((((.(((...((((((((((.(((((((.(((((...((.(.((((.(((....))).)))).)))....)))))...))))))).(((.(((((((..(((((((..((..............))..)).)))))..))))))).))).........))))))))))))).)))).))))))))))).(((((.....(((.((((....(((((((......))))))))))).))))))))...))))))))))..................(((...(((((((....((((((((.((......)).)).....))))))..)))))))...)))(((((...)))))(((.((((((((((...(((((((...((((((.....)))))).))))))).)))))))))).)))))))))..((((((........))))))......(((((((((.(((((........))))).)))))....))))...
Thermodynamic Ensemble Prediction
.((((....((((.((((((((.{,,.((((....,.)))}.(((((((({,((((,((((.(((.,.....,))).)))}{|{.{(((......))),.........((((((((((.((((((((((((,.((((....|}|},,|},..,,.,{{|,,{||{{|||,|||||.,,,),,,........{({..,}}}|{{{,,{(((,.{{(({.,((((({.{{{|,,,,}})).)}}),}))..))))......|||))}.}}}}},,))))))).)))))).))))))))))..((((.((..(((.{((((...))))...,.)))..)).)))).)))))))))))))(((((((((((((.(((..((((((((....(((((((((((((.(((((...(((((.,(.((....)).}.,)))))...))))).)}((..(((.(((((...))))).)))..)).))))))))))),{((((({...,}}}.{({(({.......,}|}}}|}|||}||{(((((({({({..,|,.}))}})))}..)))).)))..(((((((...)))))))))))))))..)))))))))))..))))).((((((...))))))....(((((((.((((.((((((((....))))))))))))(((.(((((((((((({......})).))))},,.|{||,(((((((((((....))).))))))))....,,..,,,.....(((((((((....(((.....(((.{,.....},..)))(((((.....))))).(({..(((((,...,)))))))))))...))))))))).))))).)))(((((((.{((((((((.((((((((,,.{(((((({{(((((.{(({.....}}}.,,.,.,(((((((....))))))).,{,.((({.(((..(((((.{.,....,.).))))).))).)))),,}....(((.((((....)))).)))...(((((.........))))))))))}})))))).}.,,.{((((...))))})))))))).))))))).}}..))))))).,,,(({{|{.....,||||}},........,.,,.......((((((..((({....})))..).))))))))))))..,))))))))))))....)))).((((......))))((((((,{{{..(((((((({...}))))))))...,||{|....,.,,,...,....,,.....,.....((((((((((.{{{{.(((((.((..(((..{.{{{..(((............))}}))..,..)))..)).)))))..}}||,{{{{...(((((((((.((.((((.(((...{(((((((((.(((((((.(((((...((.(.((((.(((....))).)))).))).,,.)))))...))))))).(((.(((((((..(((((((..((..............))..)).)))))..))))))).))).........)))))))))}))).)))).))))))))))),|||||}....(((.((((....(((((((......))))))))))).))),,,}}.,.))))))))))..................{({...(((((((....(((((({{{{{......,,,}}.....))))))..)))))))...}}}.,,,,,,.,,}}}|||.((((((((((...(((((((...((((((.....)))))).))))))).)))))))))).,},))))))..((((((........))))))......(((((((((.(((((........))))).)))))....))))...

Transcripts

ID Sequence Length GC content
ACUCUCACUCUCCUCCGCUCAAACUCAGCUCACUUGAGAGUCUCCUCCC… 1884 nt 0.4745
Summary

This gene encodes a member of the pentraxin protein family. The expression of this protein is induced by inflammatory cytokines in response to inflammatory stimuli in several mesenchymal and epithelial cell types, particularly endothelial cells and mononuclear phagocytes. The protein promotes fibrocyte differentiation and is involved in regulating inflammation and complement activation. It also plays a role in angiogenesis and tissue remodeling. The protein serves as a biomarker for several inflammatory conditions. [provided by RefSeq, Jun 2016]

Forensic Context

A study in human skin demonstrated that the PTX3 is significantly up-regulated in thermally injured tissue as part of the inflammatory/immune response [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A review of human studies in forensic science indicates that the PTX3 is a protein with levels elevated in acute coronary syndrome, where it is secreted by macrophages and vascular smooth muscle cells and is associated with thrombotic lesions, highlighting its potential role in elucidating causes of death such as coronary thrombosis [Raluca-Maria Cătinas et al. DOI:10.3390/ijms26146818]. A study in humans demonstrated that pentraxin 3 (PTX3) levels are elevated in acute coronary syndrome and are associated with thrombotic lesions [Cătinas et al. DOI:10.3390/ijms26146818]. In forensic contexts, PTX3 is a protein biomarker showing correlation with the severity of coronary artery lesions [Tian et al. DOI:10.1038/s41598-021-84056-5].