| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCUCACUCUCCUCCGCUCAAACUCAGCUCACUUGAGAGUCUCCUCCC… | 1884 nt | 0.4745 |
This gene encodes a member of the pentraxin protein family. The expression of this protein is induced by inflammatory cytokines in response to inflammatory stimuli in several mesenchymal and epithelial cell types, particularly endothelial cells and mononuclear phagocytes. The protein promotes fibrocyte differentiation and is involved in regulating inflammation and complement activation. It also plays a role in angiogenesis and tissue remodeling. The protein serves as a biomarker for several inflammatory conditions. [provided by RefSeq, Jun 2016]
A study in human skin demonstrated that the PTX3 is significantly up-regulated in thermally injured tissue as part of the inflammatory/immune response [Greco et al. DOI:10.1016/j.burns.2009.06.211]. A review of human studies in forensic science indicates that the PTX3 is a protein with levels elevated in acute coronary syndrome, where it is secreted by macrophages and vascular smooth muscle cells and is associated with thrombotic lesions, highlighting its potential role in elucidating causes of death such as coronary thrombosis [Raluca-Maria Cătinas et al. DOI:10.3390/ijms26146818]. A study in humans demonstrated that pentraxin 3 (PTX3) levels are elevated in acute coronary syndrome and are associated with thrombotic lesions [Cătinas et al. DOI:10.3390/ijms26146818]. In forensic contexts, PTX3 is a protein biomarker showing correlation with the severity of coronary artery lesions [Tian et al. DOI:10.1038/s41598-021-84056-5].