| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGCCGACUUCCUCCUGGUCGGCGGCUGCAGCGGGGUGAGCGGCGGCA… | 757 nt | 0.6407 | |
| GGAGCCGACUUCCUCCUGGUCGGCGGCUGCAGCGGGGUGAGCGGCGGCA… | 700 nt | 0.6343 |
This gene encodes an adaptor protein that is composed of two protein-protein interaction domains: a N-terminal PYRIN-PAAD-DAPIN domain (PYD) and a C-terminal caspase-recruitment domain (CARD). The PYD and CARD domains are members of the six-helix bundle death domain-fold superfamily that mediates assembly of large signaling complexes in the inflammatory and apoptotic signaling pathways via the activation of caspase. In normal cells, this protein is localized to the cytoplasm; however, in cells undergoing apoptosis, it forms ball-like aggregates near the nuclear periphery. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in human prostate tissues from cadavers demonstrated that the PYCARD gene, a pro-apoptotic marker, was significantly upregulated at longer postmortem intervals (96 h and 120 h) compared to a 24 h control [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. In a mouse model of mild traumatic brain injury, research showed the PYCARD transcript, involved in the induction of apoptosis, was upregulated 3.1-fold in the injured ipsilateral neocortex three days post-injury [Israelsson et al. DOI:10.1089/neu.2008.0676].