Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCGGAGCUGCGGGAGCCGGGCUGGCAGGAGCAGGAUGGCGGCGGCGG… | 1507 nt | 0.5010 | |
| AUUCGGAGCUGCGGGAGCCGGGCUGGCAGGAGCAGGAUGGCGGCGGCGG… | 1414 nt | 0.5000 |
Summary
This gene encodes the enzyme dihydropteridine reductase , which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
Forensic Context
A study in human leukocytes from severe burn patients identified the QDPR as a top sustained decreasing gene (SDG) with expression progressively declining from the healthy state through the late recovery phase (>400 hours post-injury), classifying it as a core biomarker for burn recovery [Xu et al. DOI:10.1159/000493451]. A study in *Chrysomya megacephala* demonstrated that the expression of the QDPR gene, involved in pteridine metabolism, generally decreased over a 14-day period post-eclosion under various constant and variable temperatures, showing an inverse correlation with increasing pteridine concentration and significant variation with both temperature and sex [Ngando et al. DOI:10.1016/J.Forsciint.2023.111916]. This pattern, alongside pteridine accumulation, provides a validated method for adult fly age estimation to support minimum postmortem interval determination.