| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCGGGUGUUUGUGGUGGGGCUGCGGAGUCGCCGAUCCCGCCGGAAGCG… | 1590 nt | 0.6314 |
The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]).[supplied by OMIM, Nov 2010]
No relevant information is available at the moment.