| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUUCUUUCUUCAUCUCCUCUGGCUUGGGAAAUAGACAGGAAGAGUCU… | 1347 nt | 0.4684 | |
| CUUCCUGGCCUGGGCUCCGUGCCGCUCUGUUUGCCAACCGUCCAGUCCC… | 1164 nt | 0.5129 |
This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. [provided by RefSeq, Jan 2013]
A study in humans identified the RAB13 as a potential pathogenic biomarker for sepsis, with its expression significantly increased in the peripheral blood mononuclear cells of sepsis patients compared to healthy controls [Shi et al. DOI:10.3389/fimmu.2025.1640425]. Further research in humans confirmed the RAB13 is upregulated in sepsis and its high expression is adversely associated with reduced 28-day survival, with the gene primarily expressed in monocytes [Li et al. DOI:10.1515/biol-2022-0999].