| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCCCUCAGGCGCCACUGUGAGGACCUGACCGGACCAGACCAUCCCGCA… | 12780 nt | 0.4469 |
Enables GDP binding activity; GTPase activity; and myosin V binding activity. Involved in several processes, including positive regulation of dopamine uptake involved in synaptic transmission; regulation of synaptic vesicle cycle; and regulation of vesicle size. Located in perinuclear region of cytoplasm and vesicle. Is active in dopaminergic synapse and synaptic vesicle membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the RAB3B exhibited a Gini impurity score of 0, being present in all pure seminal fluid samples and in mixtures containing semen while being absent in mixtures without semen, establishing it as a discriminatory protein for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].