| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUUGGCCAUAAAGCCUGAGGCGGCGGCAGCGGCGGAGUUGGCGGCU… | 2185 nt | 0.4668 |
RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]
A study in humans using RNA-seq data from 16 normal tissues identified the RAB7A as a housekeeping gene with highly uniform and strong expression across all examined tissues, proposing it for use as a calibration control in biotechnological applications and genomic studies [Eisenberg and Levanon DOI:10.1016/j.tig.2013.05.010].