Basic Information

Symbol
RAB8A
RNA class
mRNA
Alias
RAB8A, Member RAS Oncogene Family RAB8 MEL Mel Transforming Oncogene (Derived From Cell Line NK14) Ras-Related Protein Rab-8A Oncogene C-Mel Mel Transforming Oncogene (Derived From Cell Line NK14)- RAB8 Homolog Mel Transforming Oncogene (RAB8 Homolog) Ras-Associated Protein RAB8 EC 3.6.5.2
Location (GRCh38)
Forensic tag(s)
Individual identification

MANE select

Transcript ID
NM_005370.5
Sequence length
2567.0 nt
GC content
0.5216

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-849.30 kcal/mol
Thermodynamic ensemble
Free energy: -892.35 kcal/mol
Frequency: 0.0000
Diversity: 470.92
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.((.(((((..((......))....))))))).))..(((((..(((((.(((((.(((((((((.(((((((.((((.((((.(((.(((..((((..(.........(((((.((.....((((.((...((..((((........))))..))...((..((..((((.((((....(((.((((....((.....))((((.....((.((........)).))....))))...(((((..((((...(((.(.((.(((((((((..(((.((........)).)))............((((((((.(((((.((...((((((.((..((((((.(...((((.....))))...((.((((((..((.(..(((.....)))..).))..)))))).))....).))))....))..))))))))...))))))).))))).)))))))))))).)).).))).))))..)))))....)))).)))...)))).))))..))..))......................(((..(((....))).))))))))).....)))))))........)..))))..))).))).)))))))).))))))).))(((((((((...))))))))).......)))))))))))).))))).)))))...((.((((((((((((((((...))))))))).((((((...............)))))).....((((.((((....))))..))))((.((((.((((...(((((((.((..(((((..(((((.(((.((((((.........)))))))))...))))))))))..)).))))))).))))...)))).))))))))).)).......((((((((((((......(.(.((((((.(((((((((((.....((((.((...((((.((....(((((((((((.((((((((((.((((....((........))......(((((((((((.(((.((((((.....((..((..((((((((..((.(((((((.(((((.(((((....))))).....((((..(..(((........)))..)..))))....((((((((((((((.(((.(((((((((....(((((((...((((((.((((((((((((....)))).....))))).(((((((.....((((...((...))..)))).....)))))))....))).))))))...)))))))...))))..))).)).((((((((((........))))))..))))..((((......))))((((((((....((.(((.((((((..((((((.((((....((..........))....)))))).))))..)))))).))).))))))).)))....(((((((......(((((...(((......))).......))))).(((.....)))...........)))))))...........))).))))....(((((((((((((........))).))))..))))))..))))))))))..)))))..)).)))))..))((((((((....))))))))...(((((((.((((.((((((((((((((.((...)).))).)))))........)))))).....))))...))))))).......(((.(((((...))))).))).))))))))..))...)).....)))))))))..)))))))))))((((........((((..(((.(((...((((((((.((((((((((.......))))))).......(((....)))................((((.(((....(((.....))).....)))...))))..(((((......))))))))))))))))....))).)))..))))........)))).....((((......))))....(((((((...(((((........))))).(((..((((((.((.((((((..((((((.((.((((.((((...(((((..(((.((((.(((.((((((((.((((((((.................)))).....(((((....)))))((((..(((((((((.(.(((..((((((....))))))(((((.(((.((((((.((((((....)))))).)).)).)).)))))))).))).)))))))).))..)))))))).)))((.((((((........)))))).)).((((((.....))))))..)))))))))))))))...)))..))...))))))))....)).))).))).)))))).)).))))))..)))....((((((((((.......)).))))))))......(((((..((........))..)))))...........)))))))))))..))))))))))))))))))))).)).))))...))....(((....)))....))))))))))))........))).)))))))).....)))).))).))))).
Thermodynamic Ensemble Prediction
,,((.((.(((((..((......))....))))))).)}|.(((((..(((((.(((((.((((((((({(((((((.((((.((((.(((.(((..((((.,{..,.,{{..(((((.{(.....((((.((...||..{{{,{{,,....,,.,..{{,|.|||,((..((((.((((....(((.((((....,,,....,,((((.....{{.||,,...,..)}.}}....))}),..(((((..((((...(((.(.((.(((((((((..(((.((........)}.)))....,.......((((((((.(((((.((...((((((.((..((((((.(...((((.....))))...((.((((((..((.(..(((.....)))..).))..)))))).))....).))))....))..))))))))...))))))).))))).)))))))))))).)).).))).))))..)))))....)))).))}...)))).))))..))..,,...,,....,))).,.......|||,,|||....})),|},)})))}.....}))))))........}..))))..))).))).)))))))).)))))))...(((((((((...)))))))))}}}},..}})))))))))).))))).)))))|..{(.((((((((((((((((...))))))))|.((((((...............)))))),....((((.((((....)))),.)))),,.((((.((((...(((((((.((..(((((..(((((.(,(.((((((.........))))))}),.,.))))))))))..)).))))))).))))...)))).,)))))))).)}.......((((({{(((((..,...{.(.((((((.,{((({(({({,,,..,,,{.{{..,{|||.{|,,,.(((((((((({,((((((((((,((((....((........))......,||((((((((.(((.((((((.....((..((..((((((((..(((((,.(((({({{{.(((((....))))).....((((.{(..(({..,,....))),,)..}}))}}.})))}}}{((((((...((((((((((((....{((((((...((((((.(((((((({{{,....,})).....))))).(((((((.....((({...{{...))..}))).....))))))}....))).))))))...)))))))...))))..))).)).)))))))))|{{{.,{(((((((((..{(.({(((({....,))))||{||{{,...,((.(((.((((((..((((((.((((...,({..........},....)))))).))))..)))))).))).)))||||.}}}....{((((((.,,....|||,...{{{......|||,....,,|..,,.{((.....))).,.........)))))))........,{{{{.((((({...(((((((((((((........))).))))..))))))....,)))))...))))|,.,},}},}}}.))))))))))))}}.)))))..,...{{{(({{.{{{({((({{(((((((((.((...)).))).)))))).....,.))))),.....})))...)))))}}...,,,,{((.(((((...))))).))}.))))))))..))...)).....)))))))))..))))))))}},,,{{........((((..(({.{{,...((((((((.((((((((((.......))))))).....,.{,,...,}},.........,......((((.,,,..}}}|,{{...}))}....,,|..,}}}}.,|||,.....,,},...)))))))))))....})}.}))..))))........||||,....((((......))))....{((((((...(((((........))))).(((..((((((.((.((((((..((((((.{(,((((.((((...(((((..(((.((((.(((.((((((((.((((((((.................)))).....(((((....)))))((((..(((((((((.(.(((..((((((....))))))((((,,(((.((((((.((((((....)))))).)).)).)).)))))))).))).)))))))).))..)))))))).)))((.((((((........)))))).)).((((((.....)))))).})))))))))))))))...)))..))...))))))))..,.,,.))).))).)))))).}).}}))))..)))....{((((((({{.......)).)))))))),.,.,.(((((..{{,,,}}...}}..,,}||.......}}..))))))))))).,))))))))))))))))))))).,}.))),...)}.,...|{...,)))}...|{(((({.....}))))}},}}}.})))}},,.....))))}})}.})))).

Transcripts

ID Sequence Length GC content
GAGAGAGUGUAAUAUGGCGAAGACCUACGAUUACCUGUUCAAGCUGCUG… 2567 nt 0.5216
Summary

The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the RAB8A was identified as a differentially expressed housekeeping gene belonging to the signaling and communication class in peripheral blood leukocytes from a male monozygotic twin pair, where it was categorized within the least variable expression category [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].