| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGAGAGUGUAAUAUGGCGAAGACCUACGAUUACCUGUUCAAGCUGCUG… | 2567 nt | 0.5216 |
The protein encoded by this gene is a member of the RAS superfamily which are small GTP/GDP-binding proteins with an average size of 200 amino acids. The RAS-related proteins of the RAB/YPT family may play a role in the transport of proteins from the endoplasmic reticulum to the Golgi and the plasma membrane. This protein shares 97%, 96%, and 51% similarity with the dog RAB8, mouse MEL, and mouse YPT1 proteins, respectively and contains the 4 GTP/GDP-binding sites that are present in all the RAS proteins. The putative effector-binding site of this protein is similar to that of the RAB/YPT proteins. However, this protein contains a C-terminal CAAX motif that is characteristic of many RAS superfamily members but which is not found in YPT1 and the majority of RAB proteins. Although this gene was isolated as a transforming gene from a melanoma cell line, no linkage between MEL and malignant melanoma has been demonstrable. This oncogene is located 800 kb distal to MY09B on chromosome 19p13.1. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the RAB8A was identified as a differentially expressed housekeeping gene belonging to the signaling and communication class in peripheral blood leukocytes from a male monozygotic twin pair, where it was categorized within the least variable expression category [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].