| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUCCCUGUUAGACAUGGGCACUCCACAGAAGGAUGUUAUUAUCAAG… | 1448 nt | 0.3722 |
This gene encodes the beta-subunit of the enzyme Rab geranylgeranyl-transferase (RabGGTase), which belongs to the protein prenyltransferase family. RabGGTase catalyzes the post-translational addition of geranylgeranyl groups to C-terminal cysteine residues of Rab GTPases. Three small nucleolar RNA genes are present in the intronic regions of this gene. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 3. [provided by RefSeq, Jan 2013]
A study in mice demonstrated that the RABGGTB was identified as a network hub node among ventral midbrain (VMB) differentially expressed genes overexpressed in the methamphetamine high drinking (MAHDR) line, specifically within the black coexpression module, indicating its role in the transcriptomic network associated with differential genetic risk for voluntary methamphetamine intake [Hitzemann et al. DOI:10.3390/brainsci9070155].