| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCUGCCCCACCACCGCUGCUCCUCAGCAGGCGCCUCACCAGCCUCCA… | 1472 nt | 0.5747 |
This gene encodes a member of the Ras superfamily of small guanosine triphosphate (GTP)-metabolizing proteins. The encoded protein localizes to the plasma membrane, where it regulates diverse processes, such as secretion, phagocytosis, and cell polarization. Activity of this protein is also involved in the generation of reactive oxygen species. Mutations in this gene are associated with neutrophil immunodeficiency syndrome. There is a pseudogene for this gene on chromosome 6. [provided by RefSeq, Jul 2013]
A study in mice demonstrated that ethanol exposure during neural stem cell differentiation significantly down-regulated the expression of the RAC2 gene, which is a component of the Wnt signaling pathway, as confirmed by microarray and qRT-PCR analyses [Mandal et al. DOI:10.1007/S11033-015-3862-1].