Basic Information

Symbol
RACK1
RNA class
mRNA
Alias
Receptor For Activated C Kinase 1 Gnb2-Rs1 GNB2L1 H12.3 Guanine Nucleotide Binding Protein (G Protein), Beta Polypeptide 2-Like 1 Guanine Nucleotide-Binding Protein Subunit Beta-Like Protein 12.3 Guanine Nucleotide-Binding Protein Subunit Beta-2-Like 1 Cell Proliferation-Inducing Gene 21 Protein Receptor Of Activated Protein C Kinase 1 Small Ribosomal Subunit Protein RACK1 Human Lung Cancer Oncogene 7 Protein HLC-7 Protein Homologous To Chicken B Complex Protein, Guanine Nucleotide Binding Guanine Nucleotide Binding Protein Beta Polypeptide 2-Like 1 Receptor Of Activated Protein Kinase C 1 Receptor For Activated C Kinase Proliferation-Inducing Gene 21 Lung Cancer Oncogene 7 PIG21
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_006098.5
Sequence length
1140.0 nt
GC content
0.5342

Transcripts

ID Sequence Length GC content
CUCUCUUUCACUGCAAGGCGGCGGCAGGAGAGGUUGUGGUGCUAGUUUC… 1140 nt 0.5342
Summary

Enables several functions, including cyclin binding activity; enzyme binding activity; and protein domain specific binding activity. Involved in several processes, including regulation of macromolecule metabolic process; regulation of signal transduction; and regulation of vesicle-mediated transport. Located in several cellular components, including midbody; perinuclear region of cytoplasm; and phagocytic cup. Part of IRE1-RACK1-PP2A complex. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in rats demonstrated that the RACK1 was significantly altered in expression in liver tissue on day 2 following a 20% total body surface area burn injury, where it was classified as a signaling gene [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In a separate investigation using a methamphetamine self-administration rat model, RNA-sequencing of whisker follicles identified the RACK1 as a potential regulator of drug reward and addiction, showing a down-down regulated expression pattern (0.78 at MASA, 0.45 at WD) and a betweenness centrality score of 0.0436 [Song et al. DOI:10.1038/s41598-018-29772-1].