| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUCUUUCACUGCAAGGCGGCGGCAGGAGAGGUUGUGGUGCUAGUUUC… | 1140 nt | 0.5342 |
Enables several functions, including cyclin binding activity; enzyme binding activity; and protein domain specific binding activity. Involved in several processes, including regulation of macromolecule metabolic process; regulation of signal transduction; and regulation of vesicle-mediated transport. Located in several cellular components, including midbody; perinuclear region of cytoplasm; and phagocytic cup. Part of IRE1-RACK1-PP2A complex. [provided by Alliance of Genome Resources, Apr 2025]
A study in rats demonstrated that the RACK1 was significantly altered in expression in liver tissue on day 2 following a 20% total body surface area burn injury, where it was classified as a signaling gene [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025]. In a separate investigation using a methamphetamine self-administration rat model, RNA-sequencing of whisker follicles identified the RACK1 as a potential regulator of drug reward and addiction, showing a down-down regulated expression pattern (0.78 at MASA, 0.45 at WD) and a betweenness centrality score of 0.0436 [Song et al. DOI:10.1038/s41598-018-29772-1].