Basic Information

Symbol
RAD1
RNA class
mRNA
Alias
RAD1 Checkpoint DNA Exonuclease HRAD1 REC1 Rad1-Like DNA Damage Checkpoint Protein Cell Cycle Checkpoint Protein Hrad1 Cell Cycle Checkpoint Protein RAD1 Checkpoint Control Protein HRAD1 RAD1 Checkpoint Clamp Component DNA Repair Exonuclease REC1 Exonuclease Homolog RAD1 DNA Repair Exonuclease Rad1 Homolog Rad1-Like DNA Damage Checkpoint RAD1 (S. Pombe) Homolog RAD1 Homolog (S. Pombe) RAD1 Homolog
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002853.4
Sequence length
4512.0 nt
GC content
0.3965

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1409.60 kcal/mol
Thermodynamic ensemble
Free energy: -1496.25 kcal/mol
Frequency: 0.0000
Diversity: 832.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((.(((((((....)))))))...((((...((((((((((((..(.(..((((((((((((((.((((((.((........)).))))))))...).)))))).((..(((((((((((......))).))))))))..))((((((.(((..((((((.(((((......(((((((((...((((((.((((...(((....)))((((((.((................((((((((.((((..((((((......(((((.((((...)))))))))........)))))).)))).))...))))))...((((.......))))(((....))).....)))))))).........((((..(((((......(((((((.....))))))).......)))))...)))).....)))).))))))..)))))))))(((((((......)))))))....((((..(((((.(.((.((((......)))).))).))))).(((.(((((......))))).)))(((((((((((((((((((((....((((...((....))..))))....))))))).))))).))...))))))).............)))))))))))))))..)))...((((((((.(((.((((((.(((.......))).............((((....)))).((((......)))))))))).))).))))))))((((((((......(((((((((.....)))(((((((((((((((...)))))))).)))))))....)))))).........))))))))...........(((((((((.(((..((((.(((((........((((.(((..........(((((...)))))............))).))))....)))))))))....))))))))))))....)))))).)))))..).).))))))))))))...))))..((((.(((((((...((((.((((((.(((....(((((.....))))).....)))..)))))))))).....)))))))))))...((..((((((....))))))..))(((((..(((((((((.(.((((..............((((.((((((((((...............((((((.((....((((((...(((((((((....(((....((((..((((((..((..(((((((((((.(((((((......)))))))))))........((((((((.((((.((((((((.((.((((((((....((((((....))))))))))((((((((.(..((.((((.(((((((.(((...)))...)))))))..)).)).))..))))))))).....................)))).)).))))((((.(((((((((.((((.(((..(((((.(((((((((((.((..((((((.........((((((((((.((((((...........)))))).)).)))).)))).........))))))..))))))))).................(((((....)))))...((.....)))))).)))))(((((........))))).............)))...)))))))))))))))))...((.(((((..(((((...)))))..))))).))((((((((((((((.....((..(((......(((((((.((.((((....))))))...((((.(((.(((((((((....)))...........))))))))).))))))))))))))..))...))))))))))))))((((((((((((((......)))))))))).))))...........(((..((((((........))))))..)))(((((((((..((((..((((.(..(((.((((...(((((.((((((((((((..(((((((.....(((((.((((...)))).)))))))))))))))))))).)))))))))))))...)))..)))))..))))....))).)))))).(((((((.(((....))))))))))...((((..(((((((((((((((((.((((......((((..((..(((((.....(((((......)))))..)))))..))..))))...((((((((((((...(((.((.....)).)))...)))))))))))).....)))).))......))))).))))))))))..))))(..((((...(((((((......)))))))))))..)(.(((((......))))).))))).)))).)))))))).)))))))..))..))))))....))))..)))..)))))))))..))))))(((.....)))(((..(((((((((((((.....(((((((.....................(((.......)))......(((((((...(((((...(((((((.(((....))).)))))))...)))))......)))))))..)))))))))))))..((((...(((((..(((.(((((((((((....((((((....((((....))))))))))...)).(((.(.((((((((((............))))))))))))))(.(((.((((((.....(((((.(((((..(((((...((.(((((((..((((..(((((((((((.....(((((....)))))....))))).........(((((((((((((((((((((..(((((((((((...((((((((.............))))))))....(((((.......)))))...((((.(((.(((((...........)))))))).))))((((((((...))))))))((((.(((((((((....))).)))))).)))).(((((........)))))...((((.(((..((.((((((((((.(((........)))...)))))...))))).)).))).))))....)))))))))))))))...)))))))))))......((((.((((((((((..(((((((((((.((.((((((((((((((((((((((((((.((((.((..((((.(.(((((((.(((((((..(((.((((..(((((..((.(((...((((((((((.(((.(((((..((.(((((((((..(((.((((((((.((((((((((((((((((.((((((..((((((((((((((((..(((((((.(((((((((((((((.((((....((((.(((((((((((.((((((((.((((((((((((((.((((((((((((.((((((((((.(((..(((((((.(((((((((....)).)))))..(((((.(((..(((.((......)).))).))).))))))).)))))))....))).)))))))))).)))))))))))).)))))))))))))).)))))))).)))))))).)))))))....)))).))))).)))))))))).)))))))..))))))))))))))))...)))))).)))))))))))))))))).)))))))).)))..))))))))).))..))))).))).))))))))))...))).))..)))))..)))).)))..))))))).))))))).).))))..)).)))).))))))))))))))))))))))))))))..))))).....)))))).....))))))))))..))))...((((((........)))))).....((((((........)))))))))))).)))))).))))....((((.....(((((....))))).....)))).))))))).)).)))))..)).(((((((((......)))))))))((((((((((((...))))).......((((((....))))))(((((((((.(((.((......)))))((((((........))))))..............((((((.......))))))....)))))))))...))))))).......))).))))).....)))))).))).)((((((..((((.......................))))..)))))).....)))))))))))))))))(((((....((((((((...........))))))))....))))).................(((.(((...))))))......(((((((.((...)).))))))).(((((((....((((((((((.............)))))...))))).....)))))))))))..)))))))..))))))))))))))))))))).)))).........)))))))))))))).))))).............((((...((.......))...))))....)))...
Thermodynamic Ensemble Prediction
.....{{{.(((((((....))))))),,,((((...((((((((((((..,.(..((((((((((((((.((((((.,({{{.....))}))))))}}...),)))))).((..(((((((((((......))).))))))))..))((((((,(((..((((({{(((({......(((((((((...((((((.((((...(((....))|((((({,((........,.......((((((.,{((((..((((((...,,.((((((((((...))))))))).,,.....)))))).))})})....))))))...,(((....,,.}}}|(((....)))}....))))))))|......,,(((({,({(((((({..(((((((.....)))))))}}}},..})}))}..)))).....)))).))))))..)))))))))(((((((......)))))))..,{((((..(((((.(.((.((((......)))).))}.))))).(((.(((((......))))).))){((({{{{{((((((((((((....((((...({....}}..))))....))))))).))))).))...}}}}}}},.......,,...}))))))))))))))..)))...((((((((.(((.((((({.(((.......))).............((((....)))),((((......)))))))))).))).))))))))((((((((.....,((((((,{{.....|},((((((({(((((({...}))))))}.)))))))....))))),..}......))))))))...........(((((((((((((..((((.(((((......{,(((,.{{,...,}}}}..{((((...))))|{{{........,))).}}}}.,,.)))))))))....))))))))))))...,)))))).)))))..).,.))))))))))))...))))..{(((.(((((((...{({(.{{(((({{{(,.{,{{{{|,,}}.)))))..,,.,,,..,|||||}}}),,,,.))))))))))}....{{{{{{{{{...,})}}}{{(({,{(((..(((((((((.(.((((....,.........((((.((((((((((...............((((((.{{....((((((...(((((((((....(((....((((..((((((..((..(((((({{((,{(((((((......))))))))))}.....{,,{(((((((.((((.((({((((.((.((((((((....((((({....})))))))))((((((((.(..((.((|,.(((((((.(({...}))...)))))))..,|.)).))..))))))))).....................)))).)).))))((((.((((((((,,((((.(((..(((((.(((((((((({{((..((((((....,,...((((((((((.((((((..,......,.)))))).)).)))).)))).,,......))))))..))))))))),................(((((....)))))...,|.....,}}))).))))){((((....}}}}},.,,,,....,}},...)))...)))))))))))))))))...{(.(((((..(((((...)))))..))))).}|((((((((((((((.,{{.{{..({{....{((((((((.(,{((((....))))))...((((.(((.((((((,,{....,}}...........))))))))).))))))))))))),..)),,.))))))))))))))|{{{((((((((((......)))))))))).}|||......|||,.(((,.{{{{{|,..,,,,.})))))..},,(((((((((..((((..((((.{..(((.((((...(((((.((((((((((((..{((((((.....(((((.((({...}))).)))))))))))})))))))).)))))))))))))...)))..}))))..))))....))).)))))).((((((,{(((....))))))))))..,{(({,.((((((((((((((((((((,,..}}}}|(((..{(..({(({.....{((((......)))}}..)))))..)),,))),...((((((((((((...{{(,({.....)),}}}...)))))))))))).,...|,,,..,.}},..})))).)))))))))),.)))},,,({((..{(((((((......))))))))}}),.||.(((((......))))).))))).)))).))))))))})))))))..))..))))))....))))..)))..)))))))))..))))))(((.....)))(((..(((((((.((((((({(,(((((((...(((((((((..........(((((((...,...{{{..,,)}}|{{{(({((((,{((((((.(((....))).)))))))))))|{(((...((((......))))......)))),.........}}}}}{((,(((({...(.((....((((((,...{(((....))))))))))...)).|,...))))).))})))))))..........)))))))))....))))}.}}..})},.})))))}((((((.({.{((,.{{.,.,..,{{{.((,((((({((,,,(,{{..(((((....)))))...{|||||,{{{.....||},}}||||{{,,(((((((({{(({({(((((.,,,,(((,(({{{{{....{{{{{..,.,.................))))),...,|||}|||.|||{{...,,,,....)))}}}},.}}}}((((((((...)))))))),{((,(((((((((....)))))))))).)))}.(((((........))))),}}||||}|,,.{(({(((,(((((,.(((........)))}}})),))))}))}))},,})))}))).},.,)))|))}}||||}}|...}}}}}}}||||,|,,,,|||{.{{{{{,(((({.(((((,(((((.,(,((((((((((((((((((((((((((.((((.((..((((.(.(((((((.(((((((..(((.((((..(((((..((.(((...((((((((((.(((.(((((..((.(((((({((..(((.((((((((.((((((((((((((((({.((((((..((((((((((((((((..(((((((.(((((((((((((((.((((....((((.(((((((((((.((((((({.((((((((((((((.((((((((((((.((((((((((.(((..(((((((.{((((((((....))},)))),.(((((,((,.{((,.{,......,)}),,}))).}}))),}.)))))))....))).)))))))))).)))))))))))).)))))))))))))).}))))))).)))))))).)))))))....)))).))))),,))))))))).)))))))..))))))))))))))))...)))))).}))))))))))))))))).)))))))).)))..))})))))).))..))))).))).))))))))))...))).))..)))))..)))).)))..))))))).))))))).).))))..)).)))).)))))))))))))))))))))))))),),.))))),}}}}.})))),,}},}||||||}}}..,}}},,,{(((((.,......)))))}.{{{{(((,((,,,,,,..}|||,}.,||}|,||||{.,........{{||..,,.{{{{{....}}))}.....}}}}.,}}),))}}},,.}}},..}||||{{{{{(,{,,..,,}}}}},..,,,,,.{((((...))))}.......((((((....)))))){((((((((.(((|,({...,}|})))((((((........))))))..............((((((.......))))))....)))))))))(((((((((,{,((.....((((.,......((((({{((..(((((((..((((.......................))))..))))))).....)}))))))...,,..))))..)),))...))))))))}........,,.{((((((({......})))))))}.,,,,|||,||||,,}}}}}}......{{{(((({((...|).)))))))||||||}},...((((({{(({..,,,.......,)))))}..}))))}}}.}),)))))).....)))))))..)))}})))))))))))))))).)))).....,...)))))))))))))).)))))}}),}..,.,...((((...((.......))...))))....)))...

Transcripts

ID Sequence Length GC content
ACUUCCUCCGCGGUUCCUCGGAGCCGCCUCGCUCCUCUUCAGGGACUUU… 4512 nt 0.3965
Summary

This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]

Forensic Context

A study in mice demonstrated that the RAD1 mRNA was down-regulated (0.31-fold) in bone marrow cells 6 hours after a 6.5 Gy whole-body ionizing radiation exposure [Dai et al. DOI:10.1080/09553000600857389].