| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUCCUCCGCGGUUCCUCGGAGCCGCCUCGCUCCUCUUCAGGGACUUU… | 4512 nt | 0.3965 |
This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
A study in mice demonstrated that the RAD1 mRNA was down-regulated (0.31-fold) in bone marrow cells 6 hours after a 6.5 Gy whole-body ionizing radiation exposure [Dai et al. DOI:10.1080/09553000600857389].