| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACGUGAUCCGCAGGGCGGCCGAGGCAGGAAGCUGUGAGUGCGCGGUUGC… | 8272 nt | 0.4125 |
The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010] CIViC Summary for RAD50 Gene
A study in rats demonstrated that blast wave exposure induced a dose- and time-dependent upregulation of the RAD50 mRNA, specifically at 2 and 24 hours after a 14–15 psi exposure, as part of a broader DNA repair response indicative of severe injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].