Basic Information

Symbol
RAD50
RNA class
mRNA
Alias
RAD50 Double Strand Break Repair Protein HRad50 RAD50 Homolog, Double Strand Break Repair Protein DNA Repair Protein RAD50 RAD50-2 RAD50 (S. Cerevisiae) Homolog RAD50 Homolog (S. Cerevisiae) EC 3.6.3.27 EC 3.6.1.15 EC 3.6.-.- EC 3.6.3 RAD502 HRAD50 NBSLD
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_005732.4
Sequence length
8272.0 nt
GC content
0.4125

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2179.60 kcal/mol
Thermodynamic ensemble
Free energy: -2340.63 kcal/mol
Frequency: 0.0000
Diversity: 1883.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.(((((((((((((((((((((((..((.....((((((((..((((((.((((..((.(...).))..)))).))))(((((((((((...)))))...))))))((((...........((((((((.((((((.((.(.((((((...(((..........))).)))))).)))))))))(((..(((((((.........))))))).)))....)))))))))))).......((((((((...))).)))))....)).))))))))))))))))))))))((((((((((.((((.((.((..((((((.((((..((((....(((((((((((((((.((((((................))))))))))(((.(((((((((...(((((...(((((.....)))))....(((((((......(((((......((((((.((((((((((.......)).)).))))))...)))))).......))))))))))))......((((........)))).........(((((((...((((((((.........((((.((((((..((((....((((.((......))))))....))).)..)))))).)))).....))))).))))))))))...............(((.((((.((((((((((((((((.(((((((((..........))))))...((((((((((.((.......)).))))..))))))(((((........)))))((.((.(.(((((((((...........(((((.((((........(((.((((((.....(((...(((((.....((((((((((.........(((.(((((...))))).))).........)))))))))).....))))).)))...(((.((.(((.....))).))..)))........((((.(((((((.....((((((.((((((((((.......)))))...))).))..))))))....)))..((....))((((..(((.((((.((((..........)))).)))).)))))))...)))))))))))))).)))...(((.((((....)))).)))..........))))..)))))..........))))))))).).)).))(((.(((((((((((..............(((((((.((..(((......((((((...((((.(((((((((......)).)))))....)).)).)).)))))).....(((((((.(((.((.....((((((((....((.(((...((((...(((.((.....)).)))..))))...))).))..........(((.(((((...(((((((.(((....((((((..((.(((.(((((.............((((((((((.........)))))))))).......((...(((((((((((........)).)))))))))...)).............(((((((....))))))).............((...(((.....)))...))...)))))..)))))))))))....)))))))))).)))))...))).(((((((....(((((..((...((((((.(((((.......((((.......))))...)))))(((.((((((((((((((((......(((((........))))).(((((..(((((((((.....))))))))).))))).......)))))))..((((((...((((((((((((..((((.......))))..))).....((........))..((..(((((((.(...........).))))))).)).....((((.((.......)))))).(((((..........))))).........(((((..((....))..))).))........((..((((.(..((((....................))))..)..))))..))..)))).)))))((((((((.....)))))))).....))))))(((..((((((((.......................(((((...((((((.((((.(...((((((..((((((.((((..(((..............((((.......))))............))).)))))))..))).))).))).).))))))))))...)))))..))))))))..))).....(((((((.......(((....)))........))))))).....((((.(((...))).))))..((((.((((.....((((((.(((...(((((((((((((((........))).))))......((((((.((((...)))).))))))))))))))........(((((((((((.(((((((....))))))).))))).((((((.(((((.((.....((((((.(((........((((((....(((((......)))))(((.(....))))..((((...(((((..(((((((((.....((((((((((((((((((.(((.......((((.(((((......)))))............................(((((.....)))))((((......))))(((((......((((....))))((((((((((.(((.(....((((..(((((((....))))))).....(((((...((....))...)))))((((((.((......((((((((........(((.((((((((.........(((..((((((((..............(((((((((((((((....((((((((((...((.(..(((...........)))).))...))))))..))))...............(((((((..(((((((....))))))).(((((...(((((..(.(((........))).)..)))))..)))))...........(((((((((((((((........))))))....((((((.((......)).))))))........((((((...))))))...............((((((................((.........)).(((......))).................)))))).....((((((....))))))...((((..((((...))))..)))).............................)))))))))..........)))))))(((((((...((.(.....).)).................(((((((((...(((((......(((((.(((((............((((((..(((((((((..(((((.(((........))).)))))((((......))))..................(((((.....)))))..(((..((((.....))))..)))..(((((..(((((((((((((((................................(((((((((((.((...........(((((..........)))))...........((((((....((((((((((...(((((.......)))))...))))).....(((((.....)))))((((.((((....))))..))))....((((((((..................))))))))...((((.((((((.....((.....)).......))))))))))..)))))))))))..((((.(((..(((....)))..))))))).....)).)))))))))))........((((((...))))))..(((((((((......((((....)))).((((......)).))(((((..((....(((((...((((.((((.........((((....)))))))))))).)))))....))..)))))....)))))))))....((((((.(((((......)))))))).)))....(((((((((((((..........))))..((....))...)))))))))..........((((......))))...)))))))))))))))..)))))..........))))))))).))))))(((((.(........(((((......(((...((((......((((((.((((((.(((..((.(((((.....))))).)))))...))))...)).)))))).........)))).)))........))))).......).)))))......)))))))))).....))))).))))))))).)))))))....(((((......)))))....))))))..)))))))))(((((((((...........)))))))))......)))))))).)))....)))))))).))).))))))))..)).)))))).......)))).....).))).)))))))))))))))(((.......((((((.(((...)))...)))))).......))).((((....)))).(((((((((((.......))))))))))).......))))........))).))))))))))))))))))...))).))))))))))).)))).........)))))))).).)))))).....))))))).....))))))..))))))..))).))).))).....))))))))))))))))).))).......))))))...)).))))).((((((((.(((....((((((..........))))))))).))))))))..((((.....)))).........)))))))))))..)))).....)))))))))))).))).)).))))))).(((....)))...(((((((((((((....))))).......((((..(((......)))...)))).)))))))).(((((((((...((((........(((..(((((((((.((((.................)))).)))....))))))..))).......))))))))...)))))(((.(((((........)))))))).(((((.......)))))..((((((.((......(((((......)))))....)).))))))))))))))))))))((((.((.((.(((((.(((((((.........))))))).))))).)).)).)))).....))).))))))).......(((((..(((......(((........)))....)))))))))))))))))..))))...))).(((((((((.((..(((.(((((((((((.(((((((((......))))))..))).))).....((((.(((((....))))))))).(((...(((....))).)))))))))))))))).))))))..))).(((((((.((...((((((....))))))..)).)))))))...)))))...))))))))))))((.((((........))))))........)))))))))))))))...)))).))))))..))..((((.(((.(((((((((((((...(((((((.(((..((((((....((((((((((((...((((........))))..............................((((....))))(((((.((((....(((((.....)))))(((.((((((((......................((((((((........(((............)))......((((......))))......((.(((((((((((........)))))..((((((((.....))))))))(((((...............)))))........((((..((((.....))))..))))......)))))).)))))))))))))))))).)))..(((..(((.....((((((.................)))))))))..)))(((((..(((.(((((...........(((.(((((......)))))..)))...........)))))...)))..))))).)))).)))))(((.....)))...(((((((..((((((((((........((((...(((((.((((((((.(.((.(((((...(........)...)))))..)).).))...)))))))))))))))..)))))))))))))))))..((((.(((.(((.((((((..((((((((.....)).))))))....))))).).))).)))...))))((((...(((.((((((..........((((((....(((((((((((..(((((((.....((((.....((((((((..((((((.........))))))...))))))))..((........)).)))))))))))...))).))))))).)....))))))(((((.(..((.........))..)))))).............)))))).))).))))))))))))).)))...))))))..)))(((.(((((((...((((((((...(((((....)))))..........))))))))..........(((((..(((((((((.............)))))).((.((((((((((((((((((((((((.(((((.((((((.(((.((((((((((((.(((.((...((((.(.((...((....(((((.(((((((....((((((((.((((((((((..((((((((((..((..((((((((((..(((((((((((((..((((.((((..(((((..((((((..((((......(((..((((.(((((..(((......)))....(((.(((((((..(((((.(((....))).)))))....((((((.((......))))))))........................(((((.(((..((((((((((..............................((.(((...((((...(((.(((.....))).))).))))....))).))))))))))))....((((.......)))).(((((((..((((((((................(((((.....((((((..........((((..........)))).........((((((....)))..)))....(((((((((((.(((((((.......(((((((........((((.....))))...............(((((..............((((..............))))............((((..((((..............))))..))))..((((((....)).))))....)))))...............((((((....)))))).))))))).........((((((....).)))))..)))))))...)))))))..)))))).)))))))))))))))))..)))))))...........(((.(((......))).))).....)))...)))))....((((...(((((((.((.((......)).)).)))))))....))))....)))))))..))).((((((((............)))..))))))))))))))...((((((..(((((....)))))....))))))((..(((((....)))))...))......)))......)))).))))))..)))))..)))).))))..))))))).)))))).....))))))))))..))..))))))))))..)))))))))).))))))))))))))).)))))....))..)).).))))..))))).)))))))))))).)))..)))))).))))).))))))))))))....))))))))))))))(((((....))))).....................((((....))))......))))))))....(((.((..(((((......)))))..).).))))))))))))).))))))).))))))))))..((((.((((.........)))).)))).....)))))))))))))))).))))))))))........))..))))))))).)).(((((......))).))................(((.............))).....
Thermodynamic Ensemble Prediction
..((.(((((((((((((((((((((((..((.....((((((((..,,((((.((((..((.(...}.))..)))).))))(((((((((((...)))))...))))))...,.........,,((((((((.((((((.((.(.((((((...(((..........))).)))))).)))))))))((({,{((((({{,......,)))))))})))....)))))))),||,....,..((((((((...})).)))))....},.))))))))))))))))))))))((((((((((.((((.((,((..((((((.((((..,{{(,...((((((((((,((((.(((((({{..............))))))))))(((.(((((((((...(((((...(((((.....)))))....(((((((......(((((...,,.((((((.((((((((((.......)).)).})))))...))))))..,,.,.)))))))))))}..,,..((((........)))).........(((((((...((((((((,,.......((((.((((((..((((....((((.((......)}))))....))).)..)))))).)))),},..})))).))))))))))...............{{{.{{{{,{...((((((((,{{{.,({..{{{...{(((((((((((.,,,,((((((((((.((.......)).))))..))))))(((((........))))){{.((,(.(((((((((...........(((((.((((,.......(((.((((((...,.(((...(((((.....((((((((((.,.......(((.(((({...))))).))).......,.)))))))))).....))))).)))...{{{.((.(((.....))).)}..}}}........{({{{((((.{,.....{((({{.{{,,{{{{{{......,||||||,.,||.}}..))}}}),,}})))..((....)){(({..(((.((((.((((..........)))).)))).)))}))).,.)))))))))))))).)))...{{{.{{{{....,}}).}}}..........))}}..))))).,........))))))))).),)).}|((,{((((((((((,.........,,,..((((({(,{,...(({{,...({((((,..((((.(((((((((......)).)))},,}))...)).)).)))))}.,,..(((((({{({{(((....,(((,{((((.{.((.(((..,((((...(((.,,.....,}.)))..)))},..))).))..........(((.(((((...(((((((.(((....((((((,.{{.(({.(((((.,......,{,,.((((((({{(.{...,,|,|||}|}||}}......}||.,,||||||||{||,,.,,,.,)),}}})))}||,,,||............,||||||,..,,|||}}}}.....,,,,,..,((...(((.....)))...))...)))))..)))))))))))....)))))))))).)))))...))).(((((((....(((((..{(...((((((.(((((.......{({{.......)))}...))))|(((.((((((((,(((((((......(((((........))))).(((((.{{((((((((.....))))))))).))))).......)))))))...{((((((((((.(((..(((..((((.......))))..)))..{{{((........(({(((({(((((((.{...........}.))))))).|{,{,..(({(,((..,,,,,|}}}}}.{,(((,,{{,,....||||}.,,,........}},.{{...,)).,,||{{,......,.,..{{(((,....(((,,,,..|||{..........,|||.{{{{{(((((.(......},))))||{(((((.....)))))}}|..,,,||||||(,,..((((((((.{{{,...{{....,,..,,...{{|{|,,,((((((.((((,{...,{{{,{..{,{{{{.((({,.{{{,,.,..........((((.......))))............)},.}})))))}|))).}}}.,,,.}.))))))))))..,})))},.}))))))),,))}||...,||||||...,.{{{{{...,|},...|||,...,}}})},...((((.(((...))).))))}||||,.,|||,.,..|{{{{{|||||||{{||||||(((((((........))).))))|,,...((((((.((({...)))).)))))))))|||}|,.....,,{{{{||{||||,||(((((....))))))),}))))}||,,|..,{||}}||.....,,{(((.,((,.......,,,,,..,,|{|{{|,,,...))))})||.|,}}}}}}|,.((((...(((((,,(((((((((.....{{((((((((((((((((.{({.......(({(.(((((......))))).,.}|,.,..............,.....(((((.....)))))((((,.....,,||{{{{{......||||....}}}}((((((((((.(((.{....((((.{(((((((....))))))}.....(((((...,,....}}...)))))((((((.{(,.....((((((((........(((.((((((((....{,...{((..((((((((..............{((((((((((((((....{(({{(,.{({{{((,{..{({...........,}}.,},.}.))))))},}}}}...............(((((((..(((((({....})))))).{{{{{...(((((..,.((,{{.,...|}}),}},))))}..|||||..,,|,,,,..((((((((((((({{.....,.,))}}}}..,.((((((.((......)).))))))........{(((({...}))))}...................}}................,,......{{{||.(((,,,,..}|}..{....,,........,})}.....},|||{||,,,,)}}},,...((((..((((...))))..)))).......,..|,.......,,........}))))))))......}}..))))))){(({(((...,{.,.....}.}..................(((((((((...(((((......((((,{(((((...........,,(((((..(({{{{{{{.,||||{|{({........},,.|||||({((......}}}}...............,..((((({,...|,,||.,{{{.,|{{{..,,})})).,}}|..(((((..(((((((((((((((.........................,{{....(((((((((((.((........,,.{((((.,{....},.)))}}...........((((((....(((((((((({..{((((..,,...|||,,,,,|,,||{{{{,{((((.....,,},.((((.((((....))))..)))).,,..}}}}}}}....}})),..}}.)))}.,..))))}}.((((.((((((...,.{,.....}).......))))))))))..)))))))))))..((((.(((..(((....)))..))))))).....)).))))))))))),,,.....((((((...))))))..(((((((((....,{((({..}}))),.{{((....,.}}.}.(((((..((.,{.(((((...((((.((((..{{.,...,,||.,,.))),)))))))).))))).}..))..)))))....)))))))))....((((((.(((((......))))))))},)}....((((((((((((,...{,,,{.....,..,,..,,}})),)))))))))........,,{(((......))))...)))))))))))))))..))))),.,..,,...|||}}}}||,|}}}}},,{{{,{,{|,....((((({,.,.,}))})}{{{{,.....((((((.((((((.(((..((.(((((.....))))).)))))...))))...)).)))))).}}......})))..,,,}}...,,|||||....,}}}})))))},....)))))))))).....))))).))))))))).}))))))....{{(({......}))))....}))))},,)))))))),(((((((((,.,......,.)))))))))......)))))))).))),...)))))))).))).)))))))),.}},)))))).....,,)))).....}.))).))))))))))))))|(((,...{..((((((.(((...}))...)))))).......,,,.((((....)))).(((((((((((.......))))))))))).......)))).}}}....})).)))))))))))))))))),,,))).})))),})))).))))}}...,}}))))),}...,.,)))))......||,||,.....,}})),})..|.{(({....)))).))}}.})))))))))))))))))).))),......))))))...,),)})))}{(((((((.({{.,,,((((((..........))))))}}),)))))))},,{{{{.....)}}}.,,......))))))).),)}}),}).},,,)))))))))))).},,.}}.))))))}.,,{||.,))})..(((((((((((((....))))).......((((..(((......)))...)))).)))))))).||||,(((({{{(,(({{{{{{,.{{(..((((((,(({((((.................)))).},}}}}.))))))..}||,,....,))),..,}}}.,,)))|||.(((((........)))))|}|,(((({,,,,...))))}..||||||}{{{,....(((((......))))))).})).))))))))))))))))))))|(((.((.((.(((((.(((((((.........))))))).))))).)).)).)))}.....|||....}},(((((......))))).,...,{,{,,...,,,}}),.}))))))))))).})))}}))}).))),}})),.(((((((((.{,..(((.(((((({{(((.({(((((((,....,))))))}.))}.))}.....((((.(((({....})))))))).{{(,..(((....))).,)))))))))))))}}.))))))..))).(((((((.{(...((((({....))))))..}}.)))))))...)))))...)))))))))))){(.((((........)))))}.,{....})))))))))))}}))...)))).))))))..))..((((.((,{(((((((((((((,,.(((((((,(((..((((((....((((((((((((...,(((........,,,}.{{,,,,,,,,..............{{{,,({((,,,,|}},..|||}|||..{(((((((.....)))}..|}}|(((((({......,,..............((((((((........|{{{,.....,}{{{,{{{,,...((((......)))}......,|.||{{{{(((((({...})})))))..((((((((.....))))))))(((((...............)))))......,.((((..((((.....})))..))))......,},}}}.}}})))))))}}}}}}}|{{,.{{{({{{{{{{{.({,,{({{|{{,.,{|,,||,.,,||||........,,....{{,(((((((.((....}}.}}}}|||}(((((......)))))..,,........,,}})}},,.,,|||||||||||}|,,....((((((((((....})))||))))}((((((((((........((((...(((((.((((((((.(,{,.((((({..{.....|..},,.,,)))..)),,.))...)))))))))))))))..))))))))))..,||{{{.{,...,})}})).,(((((..((((((((.....))}}}))))..,.))))).,.|||,|.{,,{||||((((,..,(((((.{.....,,,}.}}}||,,,}}}}}|{,{||{||,..|||||||...,}||||}}}},|{{{{{{|,.((((((.........))))))...})))}}}},,||}},{{{,.||{||||||,,,,,...,},,)})))))}))}}.}},,,.,{{||}|,,{{,.....,,,)),})))))},.}}}})})),,}},)))))}..,,,..)))))))))},))...))))))..)))((,{(((((((...((((((((...(((((....})))}.....,,...))))))))..........(((((..(((,(((((..,,,,,...,,,||}}},.((.((((((((((((((((((((((((.(((((.((((((.(((.((((((((((((.(((.{(...((((.(.{(...,,.,,,(((((.(((((({...,((((((((.((((((((((..((((((((((..((..((((((((((..(((((((((((((..((((.((((..(((((.,((((((..((((,,,{,,,{{{{{{{,{{{{{,..{{{.....,|||{{,,(((,({((((,..,({{..{{{...,|||.,|,,,|}},((((((.((......}}}}))|}........................({{{{.{{{..,(((((((({.....{,,,,...,,..............,||,(((...,,,,...(((.(((.....))).))).}},,....))).}})))))))))|,,,.,..|}}},,,..{((((((((((,,((((((({...,|{.|||,|,...,,,,,.....................,|||..,......,|}|,.........||,{{{,...|,,..,||....{{{{(((((((.(((((((,......(((((((.,,.....((((.....)))}...............((((...............{{((,.........}...})))....||||,.,{(((...,,,,..........}},})})){{{{{.....||||,...,,.,,}}....,,}}}....,........,,|{((((....)))))).))))))).........{(((((....)}}}))).,)))))))...)))))))..))))},,,}}.})})}))))))))..})))}}|,,.......,}|||.{{{..,,,.}))}))}...,,))),..)))))....((((...(((((((.{{.({......}}.}}.)))))))....))))....,})))))..))),||||}}}|............},..,}}))))},}))))).}.||||||..{{{((....))))),...|||}}.{{..(((((....)))))||,|}...,,,},))},...,))).)))))).,)))))..)))).))))..))))))).)))))).....))))))))))..))..))))))))))..)))))))))).))))))))))))))).)))))....,),,)).}.))))..}}))).)))))))))))).)))..)))))).))))).)))))))))})),,,}))))))))))))))(((((....)))))...............,,....((((....))))......))))))))....(((.({..(((((......)))))..).).))))))))))))).))))))).)))))))))}..((((.{(((.........}))).)))).....)))))))))))))))).))))))))))........}}.,))))))))).)).{{(((......))).},................{({.............)}).....

Transcripts

ID Sequence Length GC content
ACGUGAUCCGCAGGGCGGCCGAGGCAGGAAGCUGUGAGUGCGCGGUUGC… 8272 nt 0.4125
Summary

The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010] CIViC Summary for RAD50 Gene

Forensic Context

A study in rats demonstrated that blast wave exposure induced a dose- and time-dependent upregulation of the RAD50 mRNA, specifically at 2 and 24 hours after a 14–15 psi exposure, as part of a broader DNA repair response indicative of severe injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].