| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGUCUUUCAAGGCAUUCCAAGCAUAAGGAAGAGCAUGAAUGAGGCCUA… | 1992 nt | 0.5873 | |
| GGACCCGGAGGUCGCGGAGAGCUGGGCAGUGUUGGCCGCUGGCGGAGCG… | 2086 nt | 0.6021 |
This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
A study in mice demonstrated that the RAD9A mRNA was down-regulated (0.31-fold) in bone marrow cells 6 hours after 6.5 Gy whole-body irradiation [Dai et al. DOI:10.1080/09553000600857389]. In primary human lung microvascular endothelial cells, RNA-seq analysis showed the RAD9A mRNA was down-regulated 1.6-fold at 24 hours following 10 Gy X-irradiation [Bouten et al. DOI:10.1038/s41598-021-03636-7].