Basic Information

Symbol
RAMP2
RNA class
mRNA
Alias
Receptor Activity Modifying Protein 2 Receptor Activity-Modifying Protein 2 CRLR Activity-Modifying Protein 2 Calcitonin Receptor-Like Receptor Activity Modifying Protein 2 Calcitonin-Receptor-Like Receptor Activity-Modifying Protein 2 Receptor (G Protein-Coupled) Activity Modifying Protein 2 Receptor (Calcitonin) Activity Modifying Protein 2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005854.3
Sequence length
752.0 nt
GC content
0.5771

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-279.80 kcal/mol
Thermodynamic ensemble
Free energy: -291.30 kcal/mol
Frequency: 0.0000
Diversity: 81.05
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....))).((((...(((((((.(((.......(((((((((..(((((((((((((((((.(((((..(((((...)))...))..))))).)))))).))))))))))).((((((((((((..((((((((.....((((....((((((((....((((...........))))...))))))))....))))))))))))((((...(((((.((((...........))))...........((((((.....))))))...(((..((((.((.((((..((((.(((((((...((((....((((.((((((((..(((.....))).))))))).).)))).....((((....)))).....(((((((((.(((((.................))))).)))))))))((((........))))...((.(((((((......))))))).))......)))).))))))).))))...)).)))).))))..))))))))...)))).))))).))))))).......)))))))))..)))..)))))))...))))..............(((((...((((..(((.(((((((.(((.(((....((((.......(((....(((..................))).....))).....))))..))).))).)))))))...)))...))))...))))).......((((((......))))))....
Thermodynamic Ensemble Prediction
.(((....))).((((.,.(((((((.{{{(,.,...(((((((((..(((((((((((((((((.(((((..(((((...)))...))..))))).)))))).))))))))))).((((((((((((.,((((((((.....((((....((((((((....((((...........))))...))))))))....)))))))))))),{({...(((((.((((...........))))...........((((((.....))))))...(((..((((.((,({({..((((.(((((((...((((.,..(((({,(((((((..(((.....))).))))))).),}))}.,,..{((({{.,,|||.....(((((((((.(((((.....{{,...,},...))))).))))))))),,|,....,}).),))}}}|{.(((((((......))))))).},......)))).))))))).))))...}},)))}.))))..)))))))}...)))).))))).))))))).......)))))))))..)))..))))))).,.))))..............(((((...((((..(((.(((((((.(((.(((....((((..,,...{{{....{{{..................})}.....)))..}..))))..))).))).)))))))...)))...))))...)))))...{{{{(.{{{....,,.))))).....

Transcripts

ID Sequence Length GC content
AGCGCCGCCGCCGCUCCUCGCCUCCUUGCUGCACGAUGGCCUCGCUCCG… 752 nt 0.5771
Summary

The protein encoded by this gene is a member of the RAMP family of single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. RAMPs are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin-gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of this (RAMP2) protein, CRLR functions as an adrenomedullin receptor. The RAMP2 protein is involved in core glycosylation and transportation of adrenomedullin receptor to the cell surface. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human samples identified the RAMP2 as a marker for endothelial cells in carotid atherosclerosis and Alzheimer's disease datasets, used for manual cell cluster annotation [Xue et al. DOI:10.3233/JAD-230559]. A separate study in mouse cardiac mesenchymal stem cells found the RAMP2 was downregulated following HDAC11 overexpression, as part of a transcriptional reprogramming linked to altered cardiovascular homeostasis [Zhang et al. DOI:10.3390/biom15050662].