| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAACAGCCGCGAGAGCAGCGGCCGCGGCGGCCGCCAGCGCGCCUUCCCC… | 3384 nt | 0.4965 |
This gene encodes a protein that binds RAN, a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The protein encoded by this gene has also been shown to interact with several other proteins, including met proto-oncogene, homeodomain interacting protein kinase 2, androgen receptor, and cyclin-dependent kinase 11. [provided by RefSeq, Jul 2008]
A study in human prostate tissue demonstrated that the RANBP9 is upregulated in samples with a high postmortem interval (PMI > 3 days) compared to a low PMI group, identifying it as an mRNA marker for PMI estimation with a role in enzyme binding molecular functions [Javan et al. DOI:10.1038/s41598-025-29561-7].