Basic Information

Symbol
ATP1A2
RNA class
mRNA
Alias
ATPase Na+/K+ Transporting Subunit Alpha 2 Sodium/Potassium-Transporting ATPase Subunit Alpha-2 Sodium Pump Subunit Alpha-2 FHM2 Sodium-Potassium ATPase Catalytic Subunit Alpha-2 Na(+)/K(+) ATPase Alpha-2 Subunit MHP2 ATPase, Na+/K+ Transporting, Alpha 2 (+) Polypeptide Sodium/Potassium-Transporting ATPase Alpha-2 Chain ATPase, Na+/K+ Transporting, Alpha 2 Polypeptide Na+/K+ ATPase, Alpha-A(+) Catalytic Polypeptide ATPase Na+/K+ Transporting Alpha 2 Polypeptide Na+/K+ ATPase, Alpha-B Polypeptide Migraine, Hemiplegic 2 EC 7.2.2.13 EC 3.6.3.9 KIAA0778 EC 3.6.3 FARIMPD DEE98
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000702.4
Sequence length
5435.0 nt
GC content
0.5310

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2004.90 kcal/mol
Thermodynamic ensemble
Free energy: -2098.32 kcal/mol
Frequency: 0.0000
Diversity: 1499.96
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((((.(((((((((....(((((((((((((((.(((((((.((((.(((..(((((........))))))))))))..))))....(((((........((((((((((.(((.((((....))))..)))))).)))))))((((...(((((.(((((((.(((.(((.(((((..((..(((((((.((((....(((..(((((.((((((.....((((.(((((((((((.....(((((((.........)))).))))))))))((((((((((.....(((((.((((....))))))))).((.((((.....)))))).((((((..((((..((((......)))).......((((((..(((...((((((((.((((((((......))).)))))..))))))))......)))..))))))((((((...)).))))(((((...)))))................)))).))))))..(((((((((((......)))).)))))))(((((((((((((((((........))))...((((((..............)))))).((((.((...(((((.((...)).)))))......(((....)))...)).))))...)))))))))))))..)))))(((((((.((((((.....(((.(((...(.((((((((....(((((((((((((.((.....(((...((((.((((....)))))))).(((((.........))))).)))....)).))))))))..(((((((((..((.((((((..(((...........))).))))))..))..)).)))))))...((((.....)))))))))))))).))).).))).)))....)))))))))))))))))).(((((((((((((...(((....((((....))))......(((((((((.(((((.....((((((((....(((((((.((...(((((.(((((..(((((..((((((((((((((((((((((((..........((((((((...((((((((((....((((...))))...))))))))))...(.((((((((.(.((........)).))).)))))).).(..(((((((((.....)))(((((((((((((((((..((((....(((((((....((((((.......))))))..........((((((((((...........))))))))))................((((((((.........).)))))))((((..................))))...)))))))))))))))))...((((........))))...)))))))))))))))))..).(((((...)))))((((((.....)))))).))))))))))))))).))))))))..((((((.....))))))......)))))))))))))).....((.((((((...........(((.((((...........)))).)))...........)))))).))...))))).))))).))))))))).(((..(((((((.((((..((((((((((((......)))))...))).))))..)))))))))))..)))..(((((...((.((((((((((..((((..((((........((((((...(((..((((((.((((((((((((((((....((((((........))))))(((....((((...))))....)))..........))))).((((((........(((((((((........)))))))))))))))(((.......))).))))))(((((((.(((((.((((((((((((....)))....)))).)))))..(((((((.(((...)))..)))))))....(((((.....(((..((((...))))..)))....((((....))))......)))))..)).))).)))))))((((((.........)))))))))))..)))))).....)))))))))))))..))))((((((((..((..((((.....((((((......))))))...))))..)).......))))).))))))))).)))).)))))))..(((....))).....((((..(((((((((((((.((((((((((.(((((((......((((.(((((.((.....)))))))))))......)))).))).))))..((((...)))))))))).)))))))))))))..)))))))).)))).)))))..)))))))))........((((((((........)))))))).)))))))))))))))))))).)))).....)))))).))).))..)))...))))..)))))...)).....))..))))).)))))).)).))))).....)))))...))))))))).(.(((((((......(((.(((((((((.((....))(((((((.(((.(((((((.....(((((((((((((((....((((..(.((((..((...............))....)))).)..))))...)))).)))))((((((...((.(((.((((((((((.((((((.((((((.(((((((((((.....((((...((((((.(((....)))))))))))))(((((((((((..(((((.(....(((((((((((((((((((.(((..(((((........(((.(((.(((((.......(((((((((((((((((((((((((((((((((((((.....))))......)).))))))).)))))))....)))))))))........(((((....((..((((((((..((((..(((((.((......)).)))))..)))))))))))))))))))..((((((..............(((((....))))))))))).))))).)))..((((.((........)))))).))))).)))))).......)))))..)))))))).........))))))...).)))))))).)))))..)))))))))))))))))))))).....................(((........)))((((((((((((.((((((....((((((((((.((((((((.(((((((.((((((((((....((((....(((((((....)))((((((.(.(((..(((.(((((((.((((......)))).))))........((((((....)))))).....(((((((........))).))))......))).)))..)))))))))))))))))).)))))))))).))))).((..((.((..........)).))..))(((((......)))))......)))))))))).))))....((((((.(((...(((((.....(((.......)))....)))))...))).)))))).((((.(((......(((((((..(((((((((((((((....(((.(((..(((((((.(((.((((..((..((((((....((((.(((((((.((((...(((....))).)))).)))))).).))))((((((..(((.....))).....))))))))))))))..)))).))).)))))))))).))).....)))))))))))))))...))))))))))))))..(((.........((((((((((((((((...(((((((((....(((((..(((....)))..)))))(((((((.....(((..((((..(.........(((((.....(.(((.(.......).))))....))))).........)..)))).))).((((..((((.((..........))....))))..))))..((((..((((..(((((...)))))))))..)))).)))))))...))))...))))).....))))).......)))))).)))))...........)))(((((((........)))))))..((((.((.........)).)))).))))))....)))))).)))))))))))))).)))).))..)))).)))))..)))))..))))).(((.((((((.....))).))).))))))))).((..((..((((((..........))))))..)).))))))))))))))).)))........)))))))..))))))))))))...))))))).).(((((.....)))))..........(((((.......))))).((((((((((((((((((.....((((((....))))))))).((((((((...((((((.(((((((..((((...)))))))))))..)))))).....))))))))((((...))))..........((((....))))(((....)))(((((((((.....((((..(((.(.((((((.....)))))).).))).))))...))))))))))))))))...))))))))....))).)))))))).....(((((.(((((((((((((((((..(((........)))..)))))).......))))).))(((((((.(((..(((.((....(((..((((((((..((.....(((((.......)))))..))..)))))))).))))))))..))).))))))).)))).)))))....((((((((...((((..(((((((((((.(((((((.....(((((((...))))))).))))..)))..)).)))))))))))))...))))))))((((....))))........)))).)))...))).))))))..)))))))))(((((((((((....((((.((.(((((...................)))))..))))))((((((......))))))((((((((....))))))))....(((((.(.....).))))).(((((((((....(((.(((..(((.......)))..))).)))..((((((((((((..((.(((.(((..((((((((((..........((((((.......))))))........)))).))))))....)))))).))..))......)))))).)))).........)))))))))..(((((((......))))))).....((((((((((((........(((((((.....((((..((((.....))))..))))........)))))))(((((...(((....)))....)))))....))))))))))))...........)).)).)))))))............
Thermodynamic Ensemble Prediction
..(((((((((.(((((((({,.,{{(((({({,((({{{|{{{{{{{.((((,(({..(((((.....,,,))}}}}))}}))..}}))}}.{{(((((....,..((((((((((.(((.((((....))))..)))))).)))))))..,,...,||||}||,,,,..,..,{{{.,(({{.,{(..,,{({{(,((((,.,.,(({{((((,.{(((,(,.|,.{{{(.{((((((((((.....(((((((.........)))).))))))))))|||,,,.,,......(((((.((({....})))))))).((.((((.....)))))).,,||||,,||{{,.,{((,...,.)))}...,,,,|{,|,|,,|||,,{(((((((({(((((((({{.,,{|||{{||,,,.|{{(({|{(..(((((|{...})}..|}|}}..})...)))|||||..}))))),.,,.....,....{{{|||.||,,||.{(((,(((((,.{{{{{{{|||{||||||{(({(((,,,,,,}||(({({{{{.{||||...((((((..{{{......}},)))))).,,,,,||...(((((.((...)).)))))...,..{{{,{{{.||{{.||{||||,..|||||||||,,,}}},,,,.((((((,,((((((.....(((.(((...{.((((((((....(((((((((((((.((...,,(((...((((.((((....)))))))).(((((.........))))).}},..},)).)))))))),.(((((((((.,(,.(((({{..(({........,..}}}.))))))..))..)).)))))))...((((.....)))))))))))))).))).}.))).)))....)))))))))))))|||||{((((((,(((,(({...,,...{(((({{....{{{{{,..{{{{,((((.({{{..{{{|(({,,||,|||||||(((((((((((((((.(((((..(((((..((((((((((((((((((((((((.{{{{{.,,.((((((((,..((((((((((....((((...))))...))))))))))...{,((({((((.,.{(,...,,|,,}.,}},)))})).,.|..(((((((((.....)))(((((((((((((((({..((((,...(((((((....{(((((.......)))))}..........((((((((((...........))))))))))................(((((((,.........}.)))))))((((....,||,....,,.,..))))...)))))))))))})))))...{(((........)))}...))))))))))))))))}{{{{(((((...))))),|||||..,|,)}))}).))))))))))))))).))))))),..((((((.....)))))).....,)))))))))))))).....({.((((((...........(((.((((.,.........)))).)))...........)))))).})...))))).)))))..((((((,..({((,....}}))}.}...)))))).(((((,....,)))))....,({(({(((({...)))))..))))})))))))))).{{{....,}|}},}|||.|}},}}),,,.....,|{...,,|||||,(((((((((((((((,.{(,(((((((((((........))))).,{{....((({,,,|}}},,{{({|.,....,{(,{{{,,|{((((({,.....,|(((((,(,..{{{{{{||||,||||(((((((...(((.((((......(((((((((.(((((.((((((((((((....)))....)))}})))))..(((((((.(((...)))..)))))))...,((({({{..{{((,.{(((...))))}})}).,,.{{((...,}}},....}.)))))}.)).))}.))))))))).)))))))...)))))),........))))}.,}}})|}})))).}.}}}}),}},}}|}|||{..(({.,(((..,,,({({{({{,,,.,}||||,..||}},.,,.......,||||,}}}))|}}}||}|,..))}))}}})))})}}))}}}))..})).}(((((((((((((.((((((((((.(((((((......((((.(((((.((.....)))))))))))......)))).))).))))..((((...)))))))))).)))))))))))))..,||{{{.{{{....|,|||{.,,,)))),}...{{{{,((((({{{.....,,,)))))))).}))),))))),|||||||,,.,)))}}),.,,,,,,.}}}.,}..}}),.}))))},)})))}}})).)).))))),})),.,)))))}))})))),....}))))).}})))))))).}|.,,|||}|}}}}}}|.}}}}.||{(((.{{,...}}}))}|))}}|}}}|}}))))}}..}}|}}}|||,..|}|}}}}..|}}}.})))).}}}}}}..}}.}}}}}},{{{{..((((((((.,.....,.)))))))).{(((,...((.(((.((((((((((.((((((.{(((((,(((((((((((,...,((((...{(((((.((,....|)))))))))))){((((((((((..(((((.(....((((((({((((((,{{{{.(((..(((((.,......(((.(((.(((((.({,({(((,(((((.((((({(((((((((((((({({{((((.....))))......||||}))))).))))))}..}}})))),})))),...,||||||,...,,.{((((({,{{,((((.,{{{{{.{{.....,)).}}}}|{{||,}}}||||||||}||||..||||||||,,,.,,,,....|||||}},,,|||||||||,..,,)).}}},})))))}}.,,...,|,.}})),))))).))))))......,)))))..)))}||||,...,,,},))))))...}.)))))))).)))))..)))))))))))))))))))))),,,.,...,,.,|,.,..,..{{|..,.....})}((((((((((((.((((((...,((((({{,,,{(((((,((((((,(((((((.(((.......((((((...(((((((((((({.(((((.(.(((..{(({{{{{||||(,{{.,,.,|)))}((((.........((((((....))))))..,..(((((((........))}.}}}}{{,{...))}))}..)))})))))}}..,..})}},,,,))),}.)))))..})))))))...,,,,....,})},...(((((......)))))})))).}.)))))),}.,,.,.},,((((((.(((...(((((..,..(((.......)))....)))))...))).))))))}})))}),,}}}}}}(((((((..(((((((((((((((....{((,((,..(((((((.(((.((((..{({,((((((....((((.(((((((.((((...(({....))).)))).)))))).).))))((((((..{((.....)))...,.))))))))))))))..)))).))).))))))),)).))).....)))))))))))))))...))))))).,,({(({.,,.........,((({((((((((((((..,(((,,{((({{{{(((((..(((....)))..)))))((((({|.....{{{..{{{{..|.,{,.....(((((.....,.(((.{.......}.))),....))))).....,},||,.}}}}.,||.((({..{.,{.|},},..,...)))}...|{{|{{.||,..((((..((((.,(((((...)))))))))..))))..)),))))))))}}}}})))),.)}}}))))).......))))))).))))...........))))}((((({....(((((((|....))))))))....})))))}))))})))})),,,,)))))).)))))))))))))},)))).))..)))).)))))..)))))..)))))..}}}|.{(((.....))).))),}((((((...))))))..,|||||}}}}}}}.)})))))),|||||||({({({{|||||,,.,..|}.|}}},}|},,..||||((({|,{{{.,,|,||}}..,||{{{,....}}})),,...,,|..{{{{,....}}})))))}|||||,|||{{|||||||,,...{((((|....})))))))).((((((((,..((((((.(((((((..((((...)))))))))))..))))))...,,))))))))((({...})))..........|||{.,,.)))}|||,...}||((({{((((,,{{.({{{..,||,|,|||{{|,....}}))}}.|,}}}.})}),.,})))))))))})}}|||,||}|}}}|}...{{.((((((((((((.(,,,((((((((.....))))}................,,,,,...{((((((...(((.{.(((((..((,({....)).))..))))).}..))))))).)))....))))..)}.}))}))))))))).)))))|||||,.(((((.({{|,|,{..(((((((.,.,,,.,..((((((((...{(((,.(((((((((((.(((((((.....(((((((...))))))).))))..)))..)).))))))))),)))...)))))))).......,).)))))))..,))))))))}..))))})))))..)))))))))|{{({{{{(,{....{{{,|{{.{((((,.....}},....,,,,,,))|}}.|||}}}}{((((,.,,,..}}}},|((((((((....)))))))),..,|{{{|,||,..,},)))))}{((((({{{,,,.{((.(((..(((.......)))..))).))}..||{{|{{{{{..,,,{{((,,{,,{,{.....}}}},},}}......,,,.(({.{{{{|{{{{{{{{,......,,.,.........}))))}}))})),)))}}})})))).))}}.........})))))))).|{{{{(((......}}}}}}}.,...((((((((((((........(((((((..,..((((..((((.....))))..)))).,}.....})))))){((((...{{(,,,.}}},,,,)))))....))))))))))))........,,,)))}).))))))}............

Transcripts

ID Sequence Length GC content
CUCUGUCUGCCAGGGUCUCCGACUGUCCCAGACGGGCUGGUGUGGGCUU… 5435 nt 0.5310
Summary

The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]

Forensic Context

No relevant information is available at the moment.