| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCGGCUCGAGUACUCCCCGUAACGAGGAGGUGUUCUCGGCCGUCCCA… | 1847 nt | 0.4164 |
The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 3 subunit. This gene encodes a beta 3 subunit. A pseudogene exists for this gene, and it is located on chromosome 2. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that spinal nerve ligation induced significant transcriptomic changes in the dorsal root ganglia, where the ATP1B3 was downregulated (0.63-fold) in the injured tissue six days post-injury [Wu et al. DOI:10.1177/1744806916629048].