Basic Information

Symbol
ATP1B3
RNA class
mRNA
Alias
ATPase Na+/K+ Transporting Subunit Beta 3 Sodium/Potassium-Transporting ATPase Subunit Beta-3 CD298 Sodium-Potassium ATPase Subunit Beta 3 (Non-Catalytic) Sodium/Potassium-Dependent ATPase Subunit Beta-3 ATPase, Na+/K+ Transporting, Beta 3 Polypeptide Sodium Pump Subunit Beta-3 FLJ29027 ATPB-3 Sodium/Potassium-Transporting ATPase Beta-3 Chain Na, K-ATPase Beta-3 Polypeptide CD298 Antigen
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_001679.4
Sequence length
1847.0 nt
GC content
0.4164

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-492.60 kcal/mol
Thermodynamic ensemble
Free energy: -531.76 kcal/mol
Frequency: 0.0000
Diversity: 662.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(.((((.((((.((.((((.......)).)).)).)))))))).)......(((((..........((((((((((((.((((.(((((.((((....)).))..)).))).))))......)))).)))))))).....((.(((((((((((.....)).))...(((((((.((((((((((..((((...))))..))).)))....))))(((((((..((((((.(((((....))).))((((...))))((((((.(((......))).))))))...(((((((((((((((((.((((((((...(((..(((((((((.((.(((((........))))).)).)).)))(((........)))))))..)))....))).)))))))))))((((((...))))))...((((..((((((.......)))))).)))).......((((.((..((.((((((..(.....((((((((...(((((((.........)))))))((((((..(((...(((((((((((((......(((((((((.(.....((((((..(((((((((((((((.(((.............)))....))))))))...)))))))))))))......((((((((.(((((....)))))((((((.((........))))))))...))))...))))).)))))))))..))))))))))))).))).........((((((.((((((((((.((((((((.((......))..)))))))).......((((((((...))))))))...)))))).)))))))))).(((((...)))))))))))......(((((..(((((.......)))))..)))))....(((((...((((((((((((.........((((((((((((.((...)).))))...))))))))....((((((((((((((((.((((((.(((((...(((((.((((((....(((((.(((........))))))))...............((.((((((.((((((((.(.(((((..((((((((.....)))))).))....)))))...((((.(((........)))..))))(((((..(((((((.((((((..((.(((((.....))))).)).((((..........)))).....(((....))).)))).)).))))))).))))).......).)))))))))))))).))............((((......)))).))))))...))))).))))))))))).)).....))))..))))))))))..)))))).))))))...)))))....)))))))).....)..)))))).))..))...))))..(((((((((((((.....)))))).))))))).(((((.((((((((((((.(((..((((((..(((....((((((...))))))....)))..))))))......))).)))))))))))).))))).((((.((((.....)))).)).))(((((......)))))..............)))))))))))...........).)))))....((((........)))))))))))............((((((..((.(((...)))..))))))))..((((((((........))))))))....((((.(((((....))))))))).))))))).(((((.......)))))..))))))).)).................)))))..........(((((.(((.....))).)))))......
Thermodynamic Ensemble Prediction
.(.((((.((((.((.((((.......)).)).)).)))))))).)..,,,,({(({,{{{{{,..,((((((((((((.((((.{((({.((({....)}.})..,},))).})}}......))))},)))))}}..,,{{{{{{{.|||.|,......,}|||.,|,.,||(((({.,((((((..((((...))))..))).)))..,})))),||{,{,..{{{,{,.{{(({,...,})}))((((...))))((((((,(((.....,}}}.}}))}}...||||||||||,{(((({{((((((((...,{,,,(,,,(((((.(({((({{..{,,,{,}}}}|.}}.,}.)))|||,,,.....},)))))..)))....)))}}}))))))))|((((({...})))))|,,({{{.,{({{((.......}}}}}}.}}}),,,.,,..|||}||,}|{|||||,{,{({{{{,{,{,.,,{{{{((({{{,...,{{{{{||||,,,{,((((........(((((((((({{{,.{(({((({(((({,(,..{,(((((({{((,,,(((((((,{{.,{,.{{,{{,,,{{.,{{{....||}|||,|{{{|,|||||}|||||{{{{{{((({.{(({(((((....||}}}((((({{((........))))))))...)),,....|))},}))))}})))}}||}}}}}}}}}}.|||,.....||.((((((.(((((((({(,((((({(({{({,,,{{||..}||}}}},.....,.{||||{{{,,,))))))},,,,)))))),)))))))))).||{{|...))}||})|)}},,|{{,(((((,,(((((.......}))))..}})))..{,||||,..|||||{|||||||}.}}}}|},||{{{{||||||,||,..}|,||||...||}}}}))}},.||||||||||..|}|||{|||,|}{{,,|}}}|||||}|||.,.,,,,{{{{{.....,,},}}},,}}}}}},..,,,..})))}))))))))))}}|,,|||,|,}...,,{,.,{({{{{|,,...}|||||{||{{{.{{{,{{,{((({{{{{,,,..,,.|||{{,}},,{{{{..||.{(((||||,|,}}}}.(((((.....)))))((((((((((({{(....(((({{{.{(((((..(({..((.((((,|,,,||.,,,,|,,...{{{{{{{({.{((({.....,)))),}}})))}||{{......||||.||.{(((((((({.,{{{|{{(({.|{{|...,}),..)))))))))}.,..,,|{||,,,,.}}}},,,,...)))))))))),)}....}))),}))))))...}))..)))))).}}|||)))....,}}.).)))}.)))))).(((((.((((((((((((.{{,..((((((..{{,.,,.((((({...})))))....)),..))))))......}},.)))))))))))).))))).((((.((((.....)))).)).)),,,...,{{{{{||||......,,,}}}}})))}}||||||{.....,,}}})}}}}}}.,,.((((........))))}))}))).....}}}}}.,},,||||}|}}}||}},}))}})))))),,..{{(((((({......|))))))}|,,..,,,,.{,{,{,|||||||}}||||,,,,||...|))|,.}}}}..))))))))))},)}}}..}}})})}}}}...,,}}}}}..........{{|||,|||.....},}})))}}.}....

Transcripts

ID Sequence Length GC content
AGUCGGCUCGAGUACUCCCCGUAACGAGGAGGUGUUCUCGGCCGUCCCA… 1847 nt 0.4164
Summary

The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 3 subunit. This gene encodes a beta 3 subunit. A pseudogene exists for this gene, and it is located on chromosome 2. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that spinal nerve ligation induced significant transcriptomic changes in the dorsal root ganglia, where the ATP1B3 was downregulated (0.63-fold) in the injured tissue six days post-injury [Wu et al. DOI:10.1177/1744806916629048].