| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCACUGAGAGCUCCAGGUAGUGAGCAGUUCAGUCGAUUUCCUCGUUA… | 4746 nt | 0.4406 | |
| AGAAUACGAGGAGGAAGAGGUGGCCAUACCGUUGACCGCUCCUCCAACU… | 3757 nt | 0.3793 |
The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012] CIViC Summary for RASA1 Gene
A study in mice demonstrated that the RASA1 transcript, a GTPase activator, exhibited increased abundance within the postmortem period [Pozhitkov et al. DOI:10.1098/rsob.160267].