| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCUUCCCCGGCUGCCGCCCCAGCCCGCCGCGGGGGCUCGGCUCCCG… | 8482 nt | 0.4583 |
RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
A study in human forensic autopsy cases using RNA sequencing demonstrated that the RASGRF2 was upregulated in a case of fatal insulin overdose, indicating its role as an additional adaptor/signaling molecule within the insulin signaling pathway [Nakao et al. DOI:10.1016/j.legalmed.2025.102772].