| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGCUCCGAGCACUUCCGGAGCCGGGCGCGGGGCCGAGGGCUGGGCCCC… | 2326 nt | 0.4596 | |
| ACUUUUCCCAGGGCGGAUGCGCCUGCGCUCAGCUGCCUGGGCGGGCUGG… | 2281 nt | 0.4450 |
This protein is a ubiquitously expressed nuclear protein and belongs to a highly conserved subfamily of WD-repeat proteins. It is found among several proteins that binds directly to retinoblastoma protein, which regulates cell proliferation. The encoded protein is found in many histone deacetylase complexes, including mSin3 co-repressor complex. It is also present in protein complexes involved in chromatin assembly. This protein can interact with BRCA1 tumor-suppressor gene and may have a role in the regulation of cell proliferation and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
A study in human dermal lymphatic endothelial cells (LECs) demonstrated that the lncRNA LETR1 is a nuclear trans-acting regulator of LEC proliferation and migration, functioning by interacting with the histone-binding protein RBBP7 [Ducoli et al. DOI:10.1038/s41467-021-21217-0]. This interaction was shown to mediate the recruitment of RNA polymerase II to the promoters of key target genes, including KLF4 and SEMA3C, thereby governing the global LEC transcriptome and cellular phenotypes.