| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCGCCACCGGGAAGGACAAGGGGACUGGGCACGGGGACCCCGGCCAGUG… | 7293 nt | 0.5102 |
This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
A study in humans demonstrated that RNA sequencing of cardiac and skeletal muscle from a sudden death patient identified an I536T variant in RBM20 via clinical exome sequencing, but this variant did not cause the expected abnormal TTN splicing, indicating it was not causative for the fatal event [Yamamoto et al. DOI:10.1016/j.forsciint.2019.109906]. Another human study identified RBM20 as a protein-coding gene neighbor of a novel long noncoding RNA that was up-regulated in ischemic cardiomyopathy, though its specific forensic application was not the primary focus of that investigation [Firat et al. DOI:10.1016/j.heliyon.2023.e13087].