| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCAAUCGUCUUCCGGCGCAGCCCCGUCCCUGUUUUUUGUGCUCCUCCG… | 4298 nt | 0.4597 |
This gene is a member of the glycine-rich RNA-binding protein family and encodes a protein with one RNA recognition motif (RRM) domain. Expression of this gene is induced by cold shock and low oxygen tension. A pseudogene exists on chromosome 1. Multiple alternatively spliced transcript variants that are predicted to encode different isoforms have been characterized although some of these variants fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the cold shock protein RBM3 showed significantly higher expression in neurocytes, alveolar epithelial cells, and renal tubular epithelial cells of a fatal hypothermia case compared to a trauma control, while its expression was lower in myocardial cells, suggesting its potential as an auxiliary diagnostic indicator for fatal hypothermia in forensic medicine [Zheng et al. DOI:10.1016/J.Jflm.2024.102786].